Técnicas de Secuenciación de
DNA
Dante Travisany F.
Tópicos
• Objetivos
• Avances
• Sanger:
– Chain Terminator
– Shotgun Sequencing
• EST
• Next Generation Sequencing NGS:
– Sequencing By Synthesis
• Illumina – SBS.
• Roche 454 – Pyrosequencing
• SOLiD – Ligation Sequencing
– Semiconduction Sequencing – Ion Torrent.
Objetivo
ATCGATCGATCGATCAGCTACGATCG
ATCGATCGATCGATCGATCAGCATCG
ATCGATCGATCGATCGATCGATCGAT
CGATCGATCGATCGATCGATCGATCG
ATCGATCGATCATTTATATTCTGCCGT
ACGACCTGACTGATCTGATCGAGTCG
ATCGACTACATATCGATCGATCGACG
ATCGTACGTATGCATGCGATCGTATCG
AGTCGTACTACGAGTCGACTGATCGT
AGTATATATGCAGCGATCGATGATCG
AGTCGATGTATTCTGACGCGATCTGA
GTCTGATGCCGTAGCAACGCTATGCT
ACTAGCTGACGTCATGCGTACGTAGT
CGTAGTACGTATCGATGCTGATGCAC
Objetivos
• Conocer:
– Las bases de la secuenciación de ADN
– Principales tecnologías de Secuenciación
– Aplicaciones de la secuenciación de ADN
Actualmente
Presente / Futuro cercano
•Costos:
•Dinero
•Computacionales
•Tiempo
Sanger
• 1977: F. Sanger y W. Gilbert - DNA Sequencing
dTTP
dCTP
dATP
Extremo 3’
dGTP
ACTGXXXXXXXXXX
TGAC
X X G-
X
X
X
TGACXXG
TGACXXXXXXXXG
TGACXG
TGACXXG
TGACXXXXXXXXG
TGACXG
TGACA
TGACXXXXXXXA
TGACXXXXXXC
TGACXXXC
TGACXXXXXT
TGACXT
TGACXXXXT
3’ G ACT T C G T A 5’
Sanger
• 1982: F. Sanger – Shotgun Sequencing
• 48.502 Nucleótidos - Primer Fago Secuenciado
• Se agrega un nuevo protocolo.
Shotgun Sequencing
1987 - Primera Secuenciadora
• ABI 370
Phred Quality Values
• Phred : Software que realiza el basecalling.
Q = -10 log(Pe)
Phred quality
score
Probability that
the base is called
wrong
Accuracy of the
base call
10
1 in 10
90%
20
1 in 100
99%
30
1 in 1,000
99.9%
40
1 in 10,000
99.99%
50
1 in 100,000
99.999%
Ejemplo Output Phred
ESTs
• Se capturan los
mRNA
• mRNA -> cDNA
• Se ensamblan los
transcritos
• Transcriptoma
Next Generation Sequencing
Introducción a la SBS
• Secuenciación por Síntesis
• Enzimas:
– Ligasa
– Polimerasa
• Tipo:
– Single Molecule
– Basada en ensamble
• Ejecución:
– Tiempo Real
– Controlada Sincrónicamente
Secuenciación Por Síntesis
• Solexa/Illumina:
– Polimerasa, Sincrónica, Basada en Ensamble
Illumina - SBS
• Se fragmenta el DNA
• Se reparan los
extremos
• Se agregan los
adaptadores
Illumina - SBS
• Se agrega el DNA a la
placa
• Se hibrida
aleatoriamente con los
adaptadores que estan
en la placa
Illumina - SBS
• Se agregan NTPs sin
marcar y DNA
polimerasa.
• Comienza la
amplificación
Illumina - SBS
• Se denatura el DNA y
se vuelve a realizar la
amplificación puente.
• Se han generado
millones de Clústers en
la placa.
Illumina - SBS
• Se agregan los dNTPs,
cada uno posee un
fluoroforo de color
particular:
–
–
–
–
G - Amarillo.
C – Azul
A – Rojo
T - Verde
• Se excita con un laser y
se captura una imagen.
Illumina - SBS
• Se excita con un laser y
se captura una imagen.
• La imagen capturada
en una posición
específica corresponde
al primer nucleótido.
Illumina - SBS
Illumina - SBS
• Los ciclos de
secuenciación se
repiten hasta
determinar la
secuencia del
templado. Una base a
la vez.
Secuenciación Por Síntesis
• Roche 454 - Pirosecuenciación:
– Polimerasa, Sincrónica, Basada en ensamble.
Roche 454- Pirosecuenciación - SBS
• El DNA es Nebulizado
• Se fragmenta en
tamaños aleatorios
Roche 454- Pirosecuenciación - SBS
• Se agregan
adaptadores
universales (Adaptador
A’ y B’) a los Extremos
• Se denatura
Roche 454- Pirosecuenciación - SBS
• Cada Perla ‘bead’
contiene miles de
adaptadores, pero solo
se le adhiere
un fragmento de DNA
que queda atrapado en
una emulsión que
contiene en su interior
los elementos para una
PCR.
Roche 454- Pirosecuenciación - SBS
• El DNA se amplifica en
esta emulsión
Generando cientos de
copias en cada perla
Roche 454- Pirosecuenciación - SBS
• Estas son puestas en la
PicoTiter Plate (PTP). El
diseño de esta permite
una bead por orificio.
Roche 454- Pirosecuenciación - SBS
454 summary



Run time: 8 Hrs
Produce 100's Mb of seq
Read length: 300bp – 400bp 2011 → 740bp!!!
Applications and Challenges

De novo sequencing

Metagenomics

Gene expression

Variation detection

Homopolymers problem
Secuenciación Por Síntesis
• ABI - Secuenciación por Ligación:
• Ligasa, Sincrónica, Basada en ensamble.
Sequenciación por Ligación - SBS
Secuenciación por Semiconducción
• Ion Torrent
Secuenciación por Semiconducción
• Al incorporarse un
núcleotido a la
hebra de ADN, la
polimerasa libera un
ion Hidrógeno.
Secuenciación por Semiconducción
• Matriz de alta
densidad de pozos
que permiten
generar este
proceso
paralelamente
• Cada pozo secuencia
una hebra.
Secuenciación por Semiconducción
Secuenciación por Semiconducción
Secuenciación por Semiconducción
Comparación Métodos
Phred
Qual
454
Vibrio parahaemolyticus
Phred
Qual
Ion Torrent - Vibrio parahaemolyticus
Aplicaciones – Tecnologías de
Secuenciación
• De novo Genome Assembly
• Secuenciación completa del genoma de un
organismo, sin referencia previa.
Aplicaciones – Tecnologías de
Secuenciación
• De novo Genome Assembly (454 o Illumina)
• Secuenciación completa del genoma de un
organismo, sin referencia previa.
•
•
•
•
•
Tamaño del Genoma
Coverage esperado
Coverage real
Complejidad del Genoma
Capacidad de Cómputo
Panda Genome
• 2.25 Gigabases -> 2.250.000.000 de
núcleotidos cubrieron el 94% del genoma.
• Sólo se utilizo Illumina.
• Se utilizaron especies de referencia para
formar los cromosomas.
Aplicaciones – Tecnologías de
Secuenciación
Aplicaciones – Tecnologías de
Secuenciación
• Metagenómica (454)
• Estudio de los metagenomas, secuenciación
del material genetico obtenido desde el
ambiente / organismo.
• Clasificación Taxonómica
• Perfil Metabólico
Aplicaciones – Tecnologías de
Secuenciación
• Metagenómica
Aplicaciones Tecnologías de
Secuenciación
• Genome Mapping (Illumina / SOLiD)
• Secuenciación con referencia, permite
identificar variantes inter/intra especies.
Variaciones estructurales, cambios en los
genomas.
• SNPs
• Variantes estructurales
Aplicaciones Tecnologías de
Secuenciación
• RNA –Seq Mapping (Illumina / SOLiD)
• Identificar expresión diferencial,
secuenciación del transcriptoma en diferentes
condiciones
• Expresión Diferencial
• SNPs
• Isoformas
Aplicaciones Tecnologías de
Secuenciación
• RNA –Seq De novo (Illumina)
• Identificar expresión diferencial, secuenciación
del transcriptoma en diferentes condiciones,
reconstrucción del transcriptoma en un
organismo, condición específico
• Obtención transcriptoma
• Expresión Diferencial
• SNPs
Gracias
Illumina –Fluorescent Reverse
Terminator
Descargar

Técnicas de Secuenciación de DNA