Biologia Molecular en Oncologia
Parte 1
Dr. Oscar Alonso Luna
1
Temas
• Genes, Genómica y Cáncer – Introducción
• Tecnologías que están revolucionado la
genómica en el tratamiento del cáncer
¿Cual es la diferencia entre estas
dos frutas?
Descubrimiento del ADN
Células y DNA
• El cuerpo humano contiene
~100 trillones de células
• Cada célula contiene 23 pares
de cromosomas
( = genoma)
• Los cromosomas contienen
DNA
Ed Radclyffe, CSIRO
• Cada célula (excepto algunas
cuantas) en un individuo
contiene exactamente el
mismo genoma
Estructura del ADN
DNA a Proteína
insulin
DNA
Código
RNA
proteína
Función
Producto
decodificado
• El DNA en el genoma se interpreta para producir proteínas
• Los segmentos del DNA en el genoma llamados “GENES”
codifican para proteínas
• Las proteínas son los productos funcionales finales en la célula.
Genomas a Organismos
Embrión de
Erizo de mar
Erizo de mar
Modificado del MCB 4a edición
Embrión de
ratón
Ratón
Embrión de
alga Fucus
Alga Fucus
Embrión
humano
Humano (conectado)
Proyecto del genoma humano
• 23 pares de cromosomas
• 3 x 109 pares de bases (o
nucleotidos)
– A, G, C & T
• Proyecto del Genoma Humano - 10
años y costó $2700 millones de
dolares
• ACGTGCATCTGACATTTACTG …..
Variaciones del genoma humano –
Polimorfismos de un solo nucleótido (SNPs)
• ~ 97 % del genoma entre dos
individuos es idéntico.
• ~ 1% de las diferencias son
variaciones de un solo nucleótido
(SNPs)
• ~2% debido a otros cambios –
variaciones en el número de
copias, deleciones
• Entre 11-12 millones de SNPs se
han identificado
Definiciones
Genética: estudio de la herencia y de alteraciones en genes; también, el estudio
de un solo gene
Genómica: estudio de genes múltiples, sus funciones, evoluación y sus
interacciones, actuando en conjunto
Pruebas pronósticas de los genes: refleje la probabilidad de un cáncer para
repetirse o la extensión fuera del sitio primario estas pruebas determina la
probabilidad que un cáncer recurrirá o se detendrá.
Pruebas Predictivas: indican la sensibilidad o la resistencia relativa a los
tratamientos específicos, tales como quimioterapia o tratamiento hormonal
Estas pruebas determinan la probabilidad que un cáncer responderá a un tipo de
tratamiento en particular.
Que es el Cáncer?
13
Mutaciones
Modified from: M. Meyerson, S.Gabriel, G.Getz, Nature Reviews Genetics 11, 685-696
Mutaciones somáticas identificadas en COLO-829
Tipo de cambio
Cuenta
Porcentaje
Sustituciones
Codificantes
Silenciosa
Missense
Truncante
No codificantes
UTR
ncRNA
miRNA
Intrónicas
Splicing
Otras
Intergénicas
Inserciones y deleciones pequeñas
Codificantes
UTR
Intrónicas
Intergénicas
Rearreglos
Puntos de ruptura
Codificantes
UTR
Intrónicos
Intergénicos
Clases
Intracromosomales
Deleciones
Inversiones
Duplicaciones
Otras
Intercromosomales
miRNA, microRNA; ncRNA, RNA no codificante; UTR, región no traducida
Genética ayuda a identificar pacientes de “High
Risk” para desarrollar Cáncer
– Genética es el estudio de la herencia
– Genetica se enfoca
primariamente en el como se
desarrolla el cáncer… BRCA1 o
BRCA2
– Genética evalúa demostrar
mutaciones, no enfermedades
Source: Understanding Cancer Series: Gene Testing,
National Cancer Institute
Genómica ayuda a buscar Pacientes de
una Biología Tumoral Individual
Genómica
Genómica es el estudio de como interactuan los genes
genes y son expresados como un todo
• Genómica y los perfiles de expresión de genes son
herramientas enfocadas en el cáncer mismo y pueden
ayudar a determinar
Cuanto agresivo es el cáncer (pronóstico)
y/o
Cuanto es beneficioso un particular tipo de
tratamiento (predicción)
La Promesa de la Genómica
• Diagnóstico temprano y efectivo
– Anticipatorio, no reactive
– Predictivo y preventive
• Mayor individualización de las decisiones de tratamiento
•
•
•
•
Terapia Dirigida basada en una enfermedad individual
Mayor posibilidad de éxito en los estudios clínicos
Más “drug discovery” racional
Desarrollo de drogas más rápido
– Selección de pacientes
– Respuesta de los pacientes
• Más rápido de comercializar
Entonces, Porqué es esto tan importante en el
Cáncer?
18
18
Expresión Génica en el Cáncer
• Sobre-expresión génica
• Mitógenos, Factores de
crecimiento.
 Oncogenes
• Silencio génico durante
la diferenciación,
Reparación del DNA,
control mitótico y
apoptosis
 Genes supresores de
tumor o anti-oncogenes
Como se activan los oncogenes?
Secuencia codificante
Deleción o Mutación
Puntual en la secuencia
codificante
Amplificación Génica
Re-arreglo Cromosómico
Proteína normal
ampliamente sobre-expresada
Amplificación cercana ó
fusión a un gen activo
DNA
RNA
Proteína hiperactiva en
cantidades normales
Combinaciones de oncogenes frecuentemente
asociados con algunos cánceres humanos
Loci Afectado
Tumor
APC, MCC, DCC, KRAS2, P53
Cáncer Colorrectal
HRAS, MYC
Carcinoma cervical
MYB, MYC, EGFR, HER2, HRAS, P53, RB1, BRCA1,
BCL1, HSTF1, INT2
Carcinoma mamario
JUN, MYC, MYCN, MYCL, HRAS, RB1, P53, RAF1
Carcinoma pulmonar
HRAS, P53, RAF1, INT2
Carcinoma de células
escamosas
MYC, BLYM
Linfoma de Burkitt
P53 (EGFR, MYC, MYCN, GLI, HER2, PDGFB, ROS,
TGF alfa
Astrocitoma
ABL
Leucemia mieloide
crónica
Que vías metabólicas están relacionadas con
el cáncer?
Anti-growth factors
(e.g. TGFb)
Tubulin
WNT
Frizzled
Dishevelled
GSK-3b
TCF
APC
Cell
b-Cutenin
E-Cadherin
p16
CdC42
ECM
TGFbR
b-Cutenin:TCF
PI3K
Integrins
Rac
Cycl D:CDK+
Fak
Src
Cas
Rb
Growth factors (e.g. EGF,
amphiregulin TGFa)
Fyn
Shc
NF1
RTK
Grb2
SOS
Ras
p27
PKC
Mos
MKKs
Ral
MEK
MAPK
Survival factors
(e.g. IGF1)
G-Prol
JNKs
Ad Cycl
Rac
E2Fs
JUN
MAPK
ELK
Max:Max
MEKK
CdC42
7-TMR
Smads
HPVE7
PLC
Abl
GPCR ligands
Nuclear receptors
(e.g. oestrogen)
p15
Crk
Fos
Myc:Max
Cycl E:CDK2
Changes
in Gene
Expression
Cell
Proliferation
(cell cycle)
Surface
Ag
p21
DNA damage
sensor
p53
Rho
PKA
CREB
ARF
MDM2
Bax
NHR (e.g. ER)
PKC
RTK
P13K
Akt
NF-kB
Akka
NF-kB
Mitochondria
Stat 3.5
Bcl-2
Cell Death
(Apoptosis)
IKB
Caspase 8
FADD
Stat 3.5
?
PTEN
Caspase 9
Fap
Cytochrome C
Stat 3.5
Bcl XL
Bad
Jaks
Abnormality
sensor
Decoy R
Bcl-2
Mitochondria
Bid
Fas
Death
factors
(e.g. FasL)
Bim, etc.
Cytokine R
Cytokines
(e.g. ILs, IFNs)
Hanahan D, Weinberg RA. Cell 2000;100:57–70
Moléculas Candidatas para mutaciones
causantes de cáncer (“oncogenes”=rojo)
Efectores
candidatos =
verde
Candidatos para
blanco= amarillo
Fallas Moleculares del Tumor Primario
Genómica Funcional
Los ensayos funcionales: Permiten perturbar los diferentes elementos del sistema
y ver las consecuencias funcionales.
Integración de Datos por Pruebas
Moleculares
Tumor Primario
Análisis Genómico
…
Una lista ordenada y
registro de genes
controladores.
• Haciendo uso de la gran escala de las pantallas funcionales que
se están acumulando rápidamente.
• Lo mejor de ambos mundos: Integración de datos de los tumores
primarios con pantallas funcionales en los datos genómicos.
Alteraciones Moleculares en la progresión
del Cáncer
p53
BRCA1
BRCA2
Normal
Growth factor,
hormone, ER
deregulation?
Hi perplasia
Displasia
- p53
- BRCA 1, 2
+HER-2
+Cyclin-D
+myc
In Situ
Carcinoma
- p53
- BRCA 1, 2
+HER-2
+Cyclin-D
+myc
Invasor
Carcinoma
Temas
• Genes, Genómica y Cáncer – Introducción
• Tecnologías que están revolucionado la
Genómica en el tratamiento del Cáncer
Tecnologías de Biología Molecular
• PCR en tiempo real
– Alta sensibilidad
– Alta precision
• DxS kit (CE)
• TIB MOLBIOL (CE)
• COBAS (CE)
MELTING CURVES
Results show GAT (G12D), GTT (G12V), AGT (G12S), and TGT (G12C) mutations at codon 12 of the K-ras
Curves represent GAT (G12D) and GTT (G12V) mutations at codon 12 of the K-ras gene.
Test usando sondas hidrolizables
Tecnologías de Secuenciación
• Tecnología de secuenciación de Primera generación
• Secuenciación Sanger
• Tecnología de secuenciación de Segunda generación
• Roche - 454
• Illumina – GA II
• SOLiD
• Tecnología de secuenciación de Tercera generación
•
•
•
•
•
Helicose
PacBio
Illumina = HiSeQ, MiSeq
Ion Torrent
Oxford Nanopore
Comparación de métodos
Sequencing
TIB
MOLBIOL
Taqman
COBAS
identical
identical
identical
identical
Tissue material
requirement
low
low
medium
low
Detection sensitivity
(low level mutations
< 5-10%)
+/-
+++
+++
+++
Work flow complexity
complex
simple
simple
simple
high
low
low
high
Probe preparation
Cost
Advantages of TIB MOLBIOL assay will allow future diagnostic application in tumor diseases with limited
tumor tissue availability (e.g. lung tumors). Additionally, simple workflow requires less personnel, which
will increase acceptance of diagnostic kit utilization.
Estrategias de la “Next Generation
Sequencing” (NGS)
• Secuenciación de Genomas completos
(WGS)
– Mutaciones somaticas en tumores
– Mutaciones de línea germinal y
polimorfismos
• Secuenciación de exomas completos (WXS)
• Secuenciación de blancos de alteraciones
accionables (ACGS)
• Soporte Informático
Ion Torrent (LifeTechnologies) – lecturas de 100bp reads, barato, fácil
El aparato personal genómico ha sido
diseñado con propósitos de investigación,
ofreciendo cargar un iPod mientras que
analiza DNA. Tiene un puerto iPod en la
parte superior…
La plataforma usa sensores
semiconductores en paralelo para medir
los iones hidrógeno producidos durante la
replicación del DNA en tiempo real (pH…).
Es el primer aparato en usar este tipo de
tecnología superconductora, mientras que
continua el uso de fluidos integrados y
micromaquinaria para traducir la
información en nuestro DNA a información
digital fácilmente medible.
http://www.iontorrent.com/?s_kwcid=TC-12648-4977112303-p-652132722
Next Generation Sequencing
Next Generation Sequencing
First Generation Sequencing
Clinical therapeutics consultation
“Drugs for a patient,
or patients for drugs.”
Manuel Hidalgo, MD
Clinical care or clinical trial
Investigación tradicional vs aplicaciones “Highthroughput”
The doctor’s perspective
Royal Mail Stamp Issue 25 February 2003
The patient’s perspective
"Here's my
sequence..."
www.nanopharmacia.com
Descargar

Genómica - Grupo RIO