Similitud de bandas en
el ejemplo del
cromosoma 1 de
Humano (H),
Chimpancé (C), Gorila
(G) y Orangután (O)
H C G O
Etcétera…
La similitud de bandas es
reflejo de una homología
profunda, cuyo
antecedente es la
secuencia de bases
nucleotídicas de la
molécula de DNA del
cromosoma. Por ejemplo,
tomemos la banda
19q13.4 del cromosoma
19 de Homo sapiens
En el sector 19q13.42 se localiza la secuencia que codifica para la proteína
RFPL4A (ret finger protein-like 4), eventualmente involucrada en la regulación de
la gametogénesis en los estados tempranos de la ontogenia)
Revise ahora en su guía la
similitud de bandas de esta
región con la
correspondiente en el
cromosoma 19 de Pan
troglodytes.
Al analizar la homología
Homo-Pan a nivel de
secuencias para el locus
RFPL4A, encontramos que
alcanza el 95%, confirmando
el significado biológico de la
similitud observada a nivel
de bandas
El % de identidad Homo vs
Pan y las tasas de
sustitución no sinónimas
respecto de las sustituciones
sinónimas (dN/dS)
corroboran el carácter
homólogo del locus
19q13.42, recién analizado
¿Qué es lo más notable aquí?
Compare los patrones de bandas :
6 cromosomas de humanos (Hu),
son similares con las bandas de
7 cromosomas de tres especies de primates.
PARTES CROMOSOMICAS
Telomero
superior
Todos los Cromosomas
tienen telómeros en
sus extremos
Centrómero
Telómero
inferior
Telómeros tienen especiales
secuencias de DNA …
ttagggttagggttagggttagggttagggttaggg…
||||||||||||||||||||||||||||||||||||
aatcccaatcccaatcccaatcccaatcccaatccc…
Enfoquemos dos cromosomas
6 cromosomas de humanos (Hu),
son similares a
7 cromosomas de tres especies de primates.
MAS PREGUNTAS…
¿Porqué DOS cromosomas
cortos de chimpancé
hubo que aparearlos con
nuestro cromosoma #2 ?
¿Pudo nuestro cromosoma #2 haberse formado a partir
de la FUSION de DOS cromosomas cortos que se
encuentran en los chimpancés de hoy (#12 y #13)?
¿Como ésto…?
Chimp
#13
Chimp
#12
Human
#2
Chimp
#13
Chimp
#12
PREDICCION
Human
#2
Si la fusión ocurrió,
entonces deberíamos
encontrar secuencias de
DNA teloméricas
precisamente en la
¿Area de
región central del
FUSION?
cromosoma 2 humano
Telómero
superior
Centrómero
Telómero
inferior
DNA
Sequencia DNA Telomérica:
ttagggttagggttaggg…
||||||||||||||||||
aatcccaatcccaatccc…
OBSERVE:
Repeticiones en Tandem en
Telómeros:
ttagggttagggttaggg…
||||||||||||||||||
aatcccaatcccaatccc…
Repetidos 800-1600 veces en
cada Telòmero
¿Qué espera Ud.?
• ¿Qué espera observar?
• Repeticiones en tandem en el area de fusion
• ¿Dónde las buscará?
• En la mitad de nuestro cromosoma #2
• ¿Dónde encontrar estas secuencias?
• Buscándolas en alguna base de datos (GenBank)
• ¿Qué puede decirse SI NO SE OBSERVAN?
• La fusion podría no haber ocurrido
RESULTADOS EN LA REGION
108061
108121
108181
108241
108301
108361
108421
108481
108541
108601
108661
108721
108781
108841
108901
108961
109021
109081
109141
109201
109261
109321
agcacagacc
ggccactgcc
gttgcagccg
gaaagaaaaa
tgcattgcag
taggggtggg
cagggtcagg
agggttgggg
tggggttggg
aaccctaccc
ctaaccctaa
accctaaccc
accctaacca
ctaccctacc
ccagccccaa
ccctaaccct
cctaacccct
ccctcaccct
ccgcctttaa
ccctcagccc
cccgaagtct
taaagagaac
tgggggtcac
tggctttgtg
tgaataatca
gcccctctga
ggtgagggtg
gttggggttg
gtcagggtta
ttggggttag
gttagggtta
ctacccctac
cccaaaccct
taacacccta
taaccctaaa
ctaaccccaa
cccttaccct
aaccctaccc
accctaaccc
aaccctcacc
ggtgcccccc
gcccgcccgg
gtgcagagga
gcaactccgc
cgtaaaggtg
acaactcggg
aggttagaga
atcctgggca
agggttaggg
gggttggggt
gggttttagg
ggttaggggt
gctaaaccta
ccctaacccc
aaccctaccc
aaaccgtgac
ccctaaccct
cccctaaccc
aaccctaccc
caaccccaaa
ctagccctag
ctcaccctaa
aggtctgtgc
gtctgacctg
gaacgcagct
cctcgcaaag
gagcagcatt
gcgcatcaac
ccagttagag
gcgagattct
tttgggttgg
taggggtagg
gttaggattt
tagggttggg
accctaaccc
aacccccacc
taaccctaac
cctgaccttg
aaaccctaac
ctaaccctaa
taacccttaa
cccaacccta
ccctagccct
cccaacgtct
tgaacagaac
agaagaactc
ccgccctcgc
gcggcgcgcc
cccctaagca
ggtgaataaa
cggttcagtg
cccaaagcaa
gtttggggtt
ggtaggggta
tagggttagg
gttggggttg
ctaaccccaa
cttaaccctt
ccaaccctaa
accctgaccc
cctaaaccct
ccctacccct
ccctaacccc
acccaaccct
aaccctaacc
gtgctgagaa
gcagctccgc
tgctccgcct
gatgctctcc
ggcggaggcg
cagaggttgg
atctttcccg
cggaaaacgg
ggcgaggggc
ggggttgggg
ggggtagggt
gtaagggtta
gggttggggt
ccccaacccc
aacccttacc
ccctaaccct
ttaaccctta
aaccctaaca
aaccccaacc
taaccctaac
aacccctaac
ctcgccctaa
gaatgctgct
cgtcgcagtg
tcgcaatagc
ggctgtgtgc
cggagaggcg
RESULTADOS
108061
108121
108181
108241
108301
108361
108421
108481
108541
108601
108661
108721
108781
108841
108901
108961
109021
109081
109141
109201
109261
109321
agcacagacc
ggccactgcc
gttgcagccg
gaaagaaaaa
tgcattgcag
taggggtggg
cagggtcagg
agggttgggg
tggggttggg
aaccctaccc
ctaaccctaa
accctaaccc
accctaacca
ctaccctacc
ccagccccaa
ccctaaccct
cctaacccct
ccctcaccct
ccgcctttaa
ccctcagccc
cccgaagtct
taaagagaac
tgggggtcac
tggctttgtg
tgaataatca
gcccctctga
ggtgagggtg
gttggggttg
gtcagggtta
ttggggttag
gttagggtta
ctacccctac
cccaaaccct
taacacccta
taaccctaaa
ctaaccccaa
cccttaccct
aaccctaccc
accctaaccc
aaccctcacc
ggtgcccccc
gcccgcccgg
gtgcagagga
gcaactccgc
cgtaaaggtg
acaactcggg
aggttagaga
atcctgggca
agggttaggg
gggttggggt
gggttttagg
ggttaggggt
gctaaaccta
ccctaacccc
aaccctaccc
aaaccgtgac
ccctaaccct
cccctaaccc
aaccctaccc
caaccccaaa
ctagccctag
ctcaccctaa
aggtctgtgc
gtctgacctg
gaacgcagct
cctcgcaaag
gagcagcatt
gcgcatcaac
ccagttagag
gcgagattct
tttgggttgg
taggggtagg
gttaggattt
tagggttggg
accctaaccc
aacccccacc
taaccctaac
cctgaccttg
aaaccctaac
ctaaccctaa
taacccttaa
cccaacccta
ccctagccct
cccaacgtct
tgaacagaac
agaagaactc
ccgccctcgc
gcggcgcgcc
cccctaagca
ggtgaataaa
cggttcagtg
cccaaagcaa
gtttggggtt
ggtaggggta
tagggttagg
gttggggttg
ctaaccccaa
cttaaccctt
ccaaccctaa
accctgaccc
cctaaaccct
ccctacccct
ccctaacccc
acccaaccct
aaccctaacc
gtgctgagaa
gcagctccgc
tgctccgcct
gatgctctcc
ggcggaggcg
cagaggttgg
atctttcccg
cggaaaacgg
ggcgaggggc
ggggttgggg
ggggtagggt
gtaagggtta
gggttggggt
ccccaacccc
aacccttacc
ccctaaccct
ttaaccctta
aaccctaaca
aaccccaacc
taaccctaac
aacccctaac
ctcgccctaa
gaatgctgct
cgtcgcagtg
tcgcaatagc
ggctgtgtgc
cggagaggcg
SUPERIOR
13
SUPERIOR
12
OBSERVE dónde habría ocurrido la fusión de telómero 13 superior con superior 12?
Descargar

resumen ppt