TEMA 5:
GENES E INGENIERÍA
GENÉTICA
1. ADN: el material de los genes
Empaquetamiento del ADN en un
cromosoma en mitosis
Estructura de la molécula de ADN
(“descubierta” en 1953 por Watson y Crik)
• El ADN es una doble cadena de nucleótidos, paralelas
y enrolladas en hélice.
• Los nucleótidos están formados por:
– Azúcar: desoxirribosa
– Fósforo (P)
– Base nitrogenada:
•
•
•
•
Adenina (A),
Timina (T),
Guanina (G)
Citosina (C)
La doble cadena estaría unida por estas bases, de manera que la A
se une a la T y la C a la G
Por ejemplo:
AAATTATGCGTGCATTGACCTAAACCCAAATTTGACTTAC
TTTAATACGCACGTAACTGGATTTGGGTTTAAACTGAATG
Funciones del ADN
• Si el ADN es el material del que están hechos
los genes, esta molécula debe realizar las
funciones que se le atribuyen a los genes:
– Contener la información genética (o hereditaria)
necesaria para realizar todas las funciones del ser
vivo. Pero ¿cómo lleva la información una molécula
de ADN?
– Controlar la aparición de los caracteres o la
realización de una función. Pero ¿cómo se
manifiesta el carácter o se realiza la función?
– Pasar la información de una célula a sus células
hijas durante el proceso de división celular. Pero
¿cómo se copia esa información que se va a
repartir?
2. El ADN contiene información
• La información vendrá dada por el orden de los
nucleótidos (de las bases nitrogenadas)
• Pero esta información tiene que traducirse a
proteínas, que hacen un trabajo determinado y darán
un carácter determinado
¿Cómo y dónde se hace esto?
• El ADN no puede salir del núcleo por lo que la información
se copia en una molécula de ARNm (mensajero). Está
formada también por nucleótidos y la información está
copiada por complementariedad: A=U, T=A, CΞG, GΞC
(está molécula no posee la timina y en su lugar tiene
uracilo)
AAATTATGCGTGCATTGACCTAAACCCAAATTTGACTTAC
TTTAATACGCACGTAACTGGATTTGGGTTTAAACTGAATG
AAAUUAUGCGUGCAUUGACCUAAACCCAAAUUUGACUUAC
(RNAm)
• El ARNm sale al citoplasma y su información se lee y
traduce en los ribosomas (el proceso se llama traducción)
Traducción de la información a proteínas
• Pero las proteínas están formadas por unidades
llamadas aminoácidos. ¿Cómo se traduce un
“lenguaje” de nucleótidos a uno de Aa?
• La secuencia de nucleótido es leída en grupos de
tres. Cada 3 nucleótidos (triplete) corresponde a
1 Aa y esa correspondencia se llama código
genético.
• Los ribosomas van identificando los tripletes y
van uniendo los Aa hasta formar las proteínas
Tercera letra
Código genético
AUG CGU GCA UUG ACC UAA ACC CAA AUU CUU UGA AC (RNAm)
Metionina- Arginina- Alanina-… -Treonina- …- Treonina- Glicina- Isoleucina-…- Stop (proteína)
Síntesis de proteínas
3. La información contenida en el ADN se copia
• Se abre la doble cadena y delante de cada una de ellas
se colocan los nucleótidos complementarios.
4. Cambios en la información genética:
mutaciones
• Las mutaciones son errores en la copia del ADN,
producidos:
– Al azar
– Inducidos por agentes mutagénicos:
• Factores físicos: rayos X
• Sustancias químicas: como sustancias que hay en el tabaco
• Las mutaciones pueden afectar:
– A 1 gen (génicas): es un error al copiar el ADN. Es la
causa de que aparezcan alelos diferentes para 1 gen
(aumentan la diversidad)
– A 1 cromosoma (cromosómicas): es un error al
repartirse los cromosomas en la mitosis o meiosis (más
importante porque forma células reproductoras)
• Una mutación puede resultar:
– Favorable: facilita la supervivencia y deja más
descendencia.
– Neutra: ni beneficia ni perjudica la descendencia (pero
permanece en la población)
– Desfavorable: los individuos que la tienen presentan
problemas para sobrevivir
• Si el medio cambia, lo que es desfavorable puede
llegar a ser favorable (o viceversa). Por ej la anemia
falciforme en lugares donde hay malaria (y ver diapositiva siguiente)
• Además de las mutaciones hay otra forma de
aumentar la diversidad ¿Cuál?
Ejemplo de variación del medio
Resumiendo: la diversidad se produce por
REPRODUCCIÓN
Intercambio de
información
Reproducción sexual
Errores en la
copia o reparto
Mutaciones
Variabilidad en la descendencia
5. La ingeniería genética
• Conjunto de técnicas que permiten quitar, poner o
modificar genes al ADN de un organismo con el fin de
cambiar su información. Los genes incorporados
pueden ser de la misma especie o de otra diferente.
• Si los organismos modificados genéticamente son
eucariotas, se dice que son transgénico.
• Si los organismos modificados son procariotas
(bacterias) se les suele denominar organismos
genéticamente modificados (OGM)
4. Los Proyectos Genoma
• Genoma es el conjunto de genes que posee un organismo.
• El “proyecto genoma” pretende secuenciar el ADN de una
especie e identificar los genes.
• El “Proyecto Genoma Humano” (PGH) comenzó en 1990 y se
completó en abril de 2003, pero se continúa con él porque, se
conoce la secuencia de nucleótidos pero se pretende interpretar
la información hasta conocer la posición de los genes y su
función.
• Características del genoma humano:
– Contiene unos 3200 millones de pares de bases
– Solo el 2% pertenece a genes con información para fabricar
proteínas (proteoma: conjunto de proteínas codificadas por un
genoma). Contiene unos 25.000 genes pero se desconoce la función
de casi la mitad de ellos
– Es casi igual para todos los seres humanos. Solo nos diferencia el
0,1%
– Casi la mitad de las proteínas humanas son muy semejantes a las de
otros seres vivos.
• Así, además de la genómica se ha iniciado una etapa proteómica o
Proyecto Proteoma.
5¿Cómo se modifica el ADN de un organismo?
APLICACIONES DE LA
INGENIERÍA GENÉTICA
• Obtención de proteínas de interés médico, comercial,
etc… (insulina, hormona del crecimiento, factores de coagulación)
• Obtención de vacunas recombinantes (aternativa al uso de
organismos patógenos inactivos)
• Diagnóstico de enfermedades de origen genético
• Tratamiento de enfermedades de origen génico:
Terapia génica
• …..
Terapia génica
• Estrategias Terapéuticas: enviar una información a
un grupo de células del organismo puede hacerse de
dos formas distintas
– Inyectando directamente el vector en el paciente (estrategia
in vivo-dentro del cuerpo)
– Inyectando el gen en células sanas del paciente que se han
extraído antes mediante una biopsia (estrategia ex vivofuera del cuerpo).
• ¿Qué tipo de células pueden emplearse en la
terapia génica? Se pueden emplear dos tipos :
– Células del propio paciente: estas células se modifican en el
laboratorio, antes de re-inyectarlas.
– Células Madre: Células con gran capacidad de multiplicarse y
que pueden generar cualquier tipo de célula de un organismo
adulto. Estas células pueden extraerse del propio paciente o
proceder de cultivos mantenidos en el laboratorio.
Plantas transgénicas
Vector: Se usa el plásmido de la bacteria Agrobacterium
tumefaciens, que es patógena de plantas. Produce tumores
Agrobacterium
núcleo
Plásmido Ti
Transgénesis= introducción de
ADN extraño en un genoma, de
modo que se mantenga estable de
forma hereditaria y afecte a
todas las células en los organismos
multicelulares.
Ingeniero
genético
natural tras
sutitución de
genes onc por
genes de
interés
cromosoma
inductor de tumores
contiene oncogenes
(genes onc)
cromosoma
célula
vegetal
tumores
Proliferación de
hormonas
crecimiento. Se
forman tumores en
las zonas de la
lesión
Resistencia a herbicidas, insectos y enfermedades microbianas
El maíz transgénico de Novartis es resistente al herbicida Basta y también es
resistente al gusano barrenador europeo (contiene el Gen de resistencia a la
toxina Bt de Bacillus thuringiensis) produce su propio insecticida
Problemas:La toxina Bt en las plantas transgénicas tiene propiedades
sustancialmente diferentes a la toxina Bt en su forma natural.
La toxina puede ser transmitida a través de la cadena alimenticia, un
efecto que nunca ha sido observado en la toxina Bt en su forma natural.
Larvas de especies de insectos predadores benéficos (larvas verdes de
crisopa) murieron cuando fueron alimentadas con el gusano barrenador
europeo
•Mejora de la calidad de los productos agrícolas
ARROZ con enzima lactoferrina de leche humana, que puede ser
utilizada para mejorar las fórmulas de leche infantil. Los niños la
necesitan para usar eficientemente el hierro y pelear contra las
infecciones (Pearson, H. Nature, 26 april 2002).
Gold rice de Monsanto con beta caroteno de genes de narciso,
pigmentos que se transforman en pro-vitamina A al ser ingeridos
•Síntesis de productos de interés comercial
Anticuerpos animales, interferón, e incluso elementos de un poliéster
destinado a la fabricación de plásticos biodegradables
Clonación
de
animales
función reproductora
con
(TRANSFERENCIA NUCLEAR DE CÉLULAS EMBRIONARIAS)
Ingeniería Genética:
NUEVOS ALIMENTOS
Salmón transgénico por
(ISB, 2001, oct; Netlink, 2000).
hormona de crecimiento.
Producido por AF Protein Inc. Cuenta con el promotor de la
proteína de anticongelamiento de otra especie de pez. Crece
de 4 a 6 veces más rápido que un salmón no transgénico.
Tiene un 20% en mejoramiento de la eficiencia de conversión
del alimento.
VACAS LECHERAS con incremento de
proteínas. En Nueva Zelanda se clonaron
vacas con óvulos mejorados genéticamente,
para mejorar la producción del queso y crema,
aumentando dos veces la kappa caseína,
crucial para hacer la cuajada y de 20% más de
beta caseina, que mejora la acción del cuajo
(Hoag, H. Nature, 27 enero 2003).
Clonan terneros en EE UU para producir anticuerpos
humanos
efe- Washington - agosto 2002
Terneros clonados y manipulados genéticamente (fábrica de anticuerpos humanos)
genes para anticuerpos
humanos recombinantes
células dérmicas
clonación
Objetivo: Tratamiento de enfermedades inmunológicas
Futuro: Tratamiento de una amplia gama de enfermedades ocasionadas por
bacterias y virus, como hepatitis, ántrax (utilizada como arma biológica)
Clonan cerdos destinados a trasplantar sus órganos a
humanos
La empresa escocesa PPL Therapeutics logra
retirar de los cerditos el gen que provoca el
rechazo en transplantes a humanos "alfa 1,3
galactosil transferasa"
Enero 2002. AP Photo/Roanoke Times, Gene Dalton (IDEAL-EFE)
Paso importante en favor del xenotrasplante (transferencia de células u
órganos de una especie a otra)
Ayudará a superar la escasez de órganos humanos para hacer trasplantes de
todo tipo
Declaración Universal de Derecho Humanos y Genoma Humano de la UNESCO (1997),
adoptada en 1998 por la Asamblea General de ONU (busca un balance entre una
continuación en las investigaciones y la salvaguarda de los derechos humanos)
Frente a los múltiples beneficios de la ingeniería genética pueden surgir
algunos problemas:
•Problemas sanitarios nuevos microorganismos patógenos, efectos
de nuevos fármacos de diseño, etc...
•Problemas ecológicos
nuevos contaminaciones, etc...
secundarios
desaparición de especies con consecuencias desconocidas,
•Problemas sociales y políticos
• Pueden crear diferencias aún más grandes entre países ricos y pobres (en el campo de la
producción industrial, agrícola y ganadera),
• El sondeo génico en personas puede llevar a consecuencias nefastas en la contratación laboral, por
ejemplo, y atenta contra la intimidad a que tiene derecho toda persona (empleo, agencias de
seguros, discriminación..).
•Problemas éticos y morales
16 de Febrero de 2001
Celera Genomics
Proyecto genoma humano
La secuencia del genoma es un atajo valioso: ayuda a los
científicos a encontrar los genes más fácil y rápidamente
y sienta las bases para averiguar la función de los genes
identificados
Beneficios médicos tras el conocimiento de la
estructura de cada gen humano
1.
Diagnóstico en individuos con riesgo de ser
portadores del gen de alguna enfermedad
2.
Marco de trabajo para el desarrollo de
nuevas
terapias,
además
de
nuevas
estrategias para la terapia génica
15 de Febrero de 2001
Consorcio público internacional
DUDAS
• ¿SI FUERA POSIBLE, A USTED LE GUSTARÍA
HACERSE UN TEST GENÉTICO QUE LE
DIJERA LAS ENFERMEDADES QUE SUFRIRÍA
EN SU VIDA?
• Reemplazar genes
defectuosos para
sanar no es
controversia,
pero...¿introducir
genes en gente
saludable para ser
más inteligente o
transformarla en
atleta, será ético?
PERO:¿CUÁNTO PODEMOS
AVANZAR?
ETICA
• Algunas aplicaciones
parecen claramente
no éticas (armas
biológicas).
• ...y muchas preguntas
no tiene una
respuesta clara.
PERO, al menos…
Un público
informado es la
mejor protección
contra
aplicaciones no
éticas o abusos
del conocimiento
biológico.
Descargar

Genes e ingeniería genética