Genes y manipulación genética
TEMA 4
El ADN: el material de los genes
 Los cromosomas están formados por ADN o
ácido desoxirribonucleico y proteínas.
 Francis Crick y James Watson (1953)
construyeron un modelo “la doble hélice”, por el
que les dieron el premio Nobel en 1962.
 Tiene las siguientes características:
GENOMA
• COMPOSICIÓN DEL ADN
Largas moléculas asociadas a proteínas formadas por unidades que
se llaman NUCLEÓTIDOS. Los nucleótidos están formados por:
Desoxirribosa. Un azúcar, que es igual en todos los nucleótidos.
Acido fosfórico, el mismo en todos los nucleótidos.
Base nitrogenada. Variable según el nucleótido, moléculas que
forman uno o dos anillos y que contienen átomos de nitrógeno.
Pueden ser:
De dos anillos: la Guanina (G) y la Adenina (A)
De un anillo: la Timina (T) y la Citosina (C).
La secuencia variable de las bases constituye información genética.
Genes y genética molecular
Los nucleótidos
ÁCIDO
FOSFÓRICO
O
O
O
P
O
N
O
N
C
O
O
BASE
NITROGENADA
AZUCAR
TAGCTAGCTAGCCTTACCTTAACCTAAACCTAGGCCTAGCCTACGGCTGCTAGCTGACTGAAGGCTTGAGC
TATATTAGCCTATATATCCTAGGCGCATTAGCTAGCTAGCCTTACCTTAACCTAAACCTAGGCCTAGCCTACG
GCTGCTAGCTGACTGAAGGCTTGAGGCCAGCTATATTAGCCTATATATCCTAGGCGCATTAGCTAGCTAGCC
TTACCTTAACCTAAACCTAGGCCTAGCCTACGGCTGCTAGCTGACTGAAGGCTTGGCCAGCTATATTAGCCT
ATATATCCTAGGCGCATTAGCTAGCTAGCCTTACCTTAACCTAAACCTAGGCCTAGCCTACGGCTGCTAGCT
GACTGAAGGCTTGAGCTATTATCCTAGGCGCATTAGCTAGCTAGCCTTACCTTAACCTAAACCTAGGCCTAG
CCTACGGCTGCTAGCTGACTGAAGGCTTGAGGCCAGCTATATTAGCCTATATATCCTAGGCGCATTAGCTAG
CTAGCCTTACCTTAACCTAAACCTAGGCCTAGCCTACGGCTGCTAGCTGACTGAAGGCTTGGCCAGCTATAT
TAGCCTATATATCCTAGGCGCATTAGCTAGCTAGCCTTACCTTAACCTAAACCTAGGCCTAGCCTACGGCTGC
TAGCTGACTGAAGGCTTGAGCTATATTAGCCTATATATCCTAGGCGCATTAGCTAGCTAGCCTTACCTTAACC
TAAACCTAGGCCTAGCCTACGGCTGCTAGCTGACTGAAGGCTTGAGGCCAGCTATATTAGCCTATATATCCT
AGGCGCATTAGCTAGCTAGCCTTACCTTAACCTAAACCTAGGCCTAGCCTACGGCTGCTAGCTGACTGAAG
GCTTGCTAGCTGACTGAAGGCTTGAGGCCAGCTATATTAGCCTATATATCCTAGGCGCATTAGCTAGCTAGC
CTTACCTTAACCTAAACCTAGGCCTAGCCTACGGCTGCTAGCTGACTGAAGGCTTGGCCAGCTATATTAGCC
TATATATCCTAGGCGCATTAGCTAGGGCTGCTAGCTGACTCTAGCCTTACCTTAACCTACCTAAACCTAGG
CCTAGCCTACGGCTGCTAGCTGACTGAAGGCTTGGCCAGCTATATTAGCCTATATATCCTAGGCG
CATTAGCTAGGGCTGCTAGCTGACTCTAGCCTTACCTTAACCTCCTAAACCTAGGCCTAGCCTAC
GGCTGCTAGCTGACTGAAGGCTTGGCCAGCTATATTAGCCTATATATCCTAGGCGCATTAGCTAG
GGCTGCTAGCTGACTCTAGCCTTACCTTAACCTCTGACTCTAGCCTTACCTTAACCTCTGACTCT
AGCCTTACC
Bases nitrogenadas
PIRIMIDÍNICAS
Timina
(exclusiva del ADN)
Citosina
Uracilo
(exclusiva del ARN)
PÚRICAS
Adenina
Guanina
Complementariedad entre las bases
Las bases de ambas
cadenas se mantienen
unidas por enlaces de
hidrógeno.
Adenina
Timina
2 Enlaces de
hidrógeno
Guanina
Citosina
3 Enlaces de
hidrógeno
El número de enlaces
de hidrógeno
depende de la
complementariedad
de las bases.
Estructura del ADN
Extremo 5’
Extremo 3’
Extremo 3’
Extremo 5’
Genes y genética molecular
La estructura de la doble hélice
Adenina
Nucleótidos
complementarios
Timina
Citosina
Nucleótidos
complementarios
Guanina
EL ADN JUNTO A SUS PROTEÍNAS SE ORGANIZA EN CROMOSOMAS
DURANTE LA DIVISIÓN CELULAR (POR ESPIRALIZACIÓN Y
ACORTAMIENTO EN SU LONGITUD)
CUARTO NIVEL:
“Cromosoma”: 50.000 veces
más cortos que toda la extensión
de su DNA contenido)
Funciones del ADN
 Llevar la información hereditaria o genética.
 Controlar la aparición de los caracteres.
 Pasar la información de una célula a sus
descendientes durante el proceso de división
celular.
LOS GENES
 En cada porción de un
cromosoma existe
información sobre un
carácter (ejemplo:
color del pelo).
 Esa porción se
denomina GEN
¿Qué información llevan los genes?
 Un gen es un segmento de ADN que lleva
codificada la información para un
determinado carácter.
 Para que aparezca el carácter es necesario
que el individuo sintetice una proteína.
 Un gen
una proteína
LOS GENES
 En un cromosoma pueden existir multitud de
genes diferentes
LOS GENES
 Los cromosomas homólogos tienen los mismos
genes ubicados en la misma posición
El código Genético
 Código o lenguaje que el ADN utiliza para
sintetizar las proteínas.
 Se basa en una secuencia de tres nucleótidos
o tripletes.
Genes y genética molecular
El dogma central de la biología molecular
ADN
TRANSCRIPCIÓN INVERSA
REPLICACIÓN
TRANSCRIPCIÓN
(en algunos virus)
ARN
TRADUCCIÓN
PROTEÍNAS
El ARN consta de una sola cadena de nucleótidos, que pueden ser adenina, guanina, citosina y uracilo.
Adenina
Uracilo
Complementarios
Citosina
Guanina
Complementarios
Hay varios tipos de ARN
ARN mensajero
Copia la información de un
gen y la lleva a los ribosomas.
ARN transferente
ARN ribosómico
Transporta aminoácidos
hasta los ribosomas para
formar proteínas.
Forma los ribosomas junto
con ciertas proteínas.
ADN
Aminoácidos
Ribosomas
Transcripción
ARN mensajero
Proteína
Genes y genética molecular
La replicación
Cadena
complementari
a
ADN
La doble hélice se abre
y las dos cadenas de
nucleótidos se
separan.
Se forman dos
cadenas nuevas,
cada una
complementaria de
su original.
Cadena
original
Cambios en la información genética:
Mutaciones
 La aparición de forma súbita y al azar de
cambios en el ADN recibe el nombre de
mutación.
 Pueden ser naturales o estimuladas mediante
agentes mutagénicos:
 Radiaciones: rayos x, la luz ultravioleta o la
radiación atómica.
 Sustancias químicas: como el ácido nitroso.
MUTACIÓN GÉNICA
MUTACIÓN CROMOSÓMICA
MUTACIÓN GENÓMICA EN AUTOSOMAS
MUTACION EN CROMOSOMAS SEXUALES
SINDROME DE KLINEFELTER
MANIFESTACIONES
No todas estas
manifestaciones se dan en
un mismo individuo:
- Talla elevada
- Mayor acumulación de
grasa subcutánea
- Dismorfia facial discreta
- Alteraciones dentarias
- En ocasiones criptorquidia,
micropene, escroto
hipoplásico o malformaciones
en los genitales.
- Esterilidad por
azoospermia.
- Ginecomastia uni o bilateral
- Vello pubiano disminuido
- Gonadotrofinas elevadas en
la pubertad
- Disminución de la líbido
- Retraso en el área del
lenguaje, lectura y
comprensión
- Lentitud, apatía.
- Trastornos emocionales,
ansiedad, depresión, etc.
- Falta de autoestima.
¿Se heredan las mutaciones?
 Si ocurre en una célula no reproductora la
mutación desaparecerá con la muerte celular
o del organismo. Pueden producir tumores.
 Si se produce en las células reproductoras, la
mutación se transmitirá de generación en
generación con la reproducción.
La ingeniería genética
 Permite identificar y aislar genes concretos y
producir copias idénticas de un gen.
 El gen clonado puede ser transferido a células
que fabricarán el producto que codifican.
Se extrae el plásmido que
tiene la bacteria además
de su material genético.
Se aisla el gen que codifica
la insulina humana.
Se introduce el gen
en el plásmido.
La insulina puede
ser empleada para
tratar la diabetes.
Se introduce de nuevo
en una bacteria.
Bacterias que sintetizan
insulina humana.
Organismos transgénicos
 Organismos cuyo genoma se ha modificado
mediante ingeniería genética se llaman
organismos modificados genéticamente.
 Los OMG pueden ser procariotas o
eucariotas. Los eucariotas se llaman
organismos transgénicos.
ADN bacteriano
Gen responsable de la toxicidad
El material genético de la
bacteria se ha insertado
en el ADN de la planta.
Bacillus thuringiensis
Se corta el ADN y se
selecciona el fragmento
que tiene el gen para
sintetizar el tóxico.
Se introduce el
ADN bacteriano
en la célula.
Se cultivan
las células en
el laboratorio.
ADN planta
Planta de maíz
no resistente a
insectos.
Célula vegetal
Plantas de maíz
resistentes a
insectos.
Producción de organismos
transgénicos
 1ª etapa o transformación: se introduce el
gen deseado en el genoma de una célula del
organismo que se quiere modificar.
 2ª etapa o de regeneración, en la que se
obtiene la planta o animal a partir de la célula
cuyo genoma se ha modificado
genéticamente. En esta etapa se requiere
hacer clonaciones para obtener el mayor
número de copias.
PROYECTO GENOMA
Principales objetivos de este proyecto
 Identificar todos los genes humanos.
 Realizar mapas genéticos que indiquen la
Datos comparativos de genomas de
diferentes animales con el ser humano.
Gusano 19.000 genes
Mosca 13.000 genes
posición relativa de los diferentes genes.
 Confeccionar mapas físicos que presenten
la secuencia de nucleótidos de cada gen.
20% idéntico
60% idéntico
Humanos
30.000 genes
70% idéntico
El bandeado cromosómico identifica
regiones concretas de ADN.
Ratón 30.000 genes
98% idéntico
Chimpancé 30.000 genes
Aplicaciones del PGH
 Aplicaciones directas en el campo de la salud:
 Diagnóstico de enfermedades hereditarias
 Fabricación de medicamentos
 Terapia génica