http://web.educastur.princast.es/proyectos/biogeo_ov/4a_ESO/06_genetica/A
nimaciones.htm
Unidad básica: nucleótido
Los peldaños formados por los nucleótidos son complementarios.
La posición de una A en una de las cadenas se corresponde con
una T en la otra cadena...
De igual forma, la posición de una G en una de las cadenas se
corresponde con una C en la misma posición de la otra cadena.
El esquema de este “dogma” ha sido encontrado repetidamente
y se considera una regla general (salvo en los retrovirus)
Proteína
genoma
Célula
cromosomas
genes
ADN
proteínas
las proteínas actúan
solas o en complejos
para realizar las
funciones celulares
los genes
contienen
instrucciones
para hacer
proteínas
La primera ley de Mendel:.
Ley de la uniformidad de
los híbridos de la primera
generación: Cuando se
cruzan dos variedades
individuos de raza pura
ambos (homocigotos ) para
un determinado carácter,
todos los híbridos de la
primera generación son
iguales.
Mendel llegó a esta
conclusión al cruzar
variedades puras de
guisantes amarillas y verdes
pues siempre obtenía de este
cruzamiento variedades de
guisante amarillas.
AA
X
A
aa
a
Aa
Leyes de Mendel
Primera ley de Mendel (dominancia)
Enunciado de la ley: A esta ley se le llama también Ley de la
uniformidad de los híbridos de la primera generación (F1) ó
Principio de Dominancia. , y dice que cuando se cruzan dos
variedades individuos de raza pura ambos (homocigotos ) para
un determinado carácter, todos los híbridos de la primera
generación son iguales
Primera ley (herencia intermedia)
La primera ley de Mendel se cumple también para el caso en
que un determinado gen de lugar a una herencia intermedia y
no dominante, como es el caso del color de las flores del
"dondiego de noche" (Mirabilis jalapa). Al cruzar las plantas de
la variedad de flor blanca con plantas de la variedad de flor
roja, se obtienen plantas de flores rosas. La interpretación es la
misma que en el caso anterior, solamente varía la manera de
expresarse los distintos alelos.
Segunda ley de Mendel(dominancia)
Enunciado de la ley: A la segunda ley de Mendel también
se le llama de la separación o disyunción de los alelos.
Los dos alelos distintos para el color de la semilla
presentes en los individuos de la primera generación
filial, no se han mezclado ni han desaparecido ,
simplemente ocurría que se manifestaba sólo uno de los
dos
Genotipos: AA, Aa , Aa, aa
Fenotipos : Amarillo, Verde.
Proporcion 3:1
2a ley herencia intermedia
En el caso de los genes que presentan herencia
intermedia, también se cumple el enunciado de la
segunda ley. Si tomamos dos plantas de flores rosas de
la primera generación filial (F1) del cruce que se
observa en la figura 2 y las cruzamos entre sí, se
obtienen plantas con flores blancas, rosas y rojas, en la
proporción que se indica en el esquema de la figura
4.También en este caso se manifiestan los alelos para
el color rojo y blanco, que permanecieron ocultos en la
primera generación
La segunda ley de Mendel:.
Ley de la separación o
disyunción de los alelos.
Mendel tomó plantas
procedentes de las semillas de la
primera generación (F1) del
experimento anterior, amarillas
Aa, y las polinizó entre sí. Del
cruce obtuvo semillas amarillas y
verdes en la proporción 3:1 (75%
amarillas y 25% verdes). Así
pues, aunque el alelo que
determina la coloración verde de
las semillas parecía haber
desaparecido en la primera
generación filial, vuelve a
manifestarse en esta segunda
generación.
X
Aa
A
Aa
A
a
a
A
a
A
AA
Aa
a
Aa
aa
Más información en :http://www.arrakis.es/~lluengo/genemende.html#GlossSegunda
La Tercera Ley de Mendel:.
Ley de la independencia de los
caracteres no antagónicos.
Mendel se planteó cómo se
heredarían dos caracteres. Para
ello cruzó guisantes amarillos
lisos con guisantes verdes
rugosos.
En la primera generación obtuvo
guisantes amarillos lisos.
AABB
X
AB
AaBb
aabb
P
ab
G
F1
(i+2)
http://www.bioygeo.info/Problemas_gen2.htm
http://www.bioygeo.info/Geomorfologia.htm
3a Ley de Mendel
Enunciado de la ley: Se conoce esta ley como la de la
herencia independiente de caracteres, y hace referencia
al caso de que se contemplen dos caracteres distintos.
Cada uno de ellos se transmite siguiendo las leyes
anteriores con independencia de la presencia del otro
carácter.
El experimento de Mendel: Mendel cruzó plantas de
guisantes de semilla amarilla y lisa con plantas de
semilla verde y rugosa (Homocigóticas ambas para los
dos caracteres).
Las semillas obtenidas en este cruzamiento eran todas
amarillas y lisas, cumpliéndose así la primera ley para
cada uno de los caracteres considerados , y revelándonos
también que los alelos dominantes para esos caracteres
son los que determinan el color amarillo y la forma lisa.
Las plantas obtenidas y que constituyen la F1 son
dihíbridas (AaBb).
Para F2
Los resultados de los experimentos de la tercera ley refuerzan el
concepto de que los genes son independientes entre sí, que no se
mezclan ni desaparecen generación trás generación.
La Tercera Ley de Mendel:.
AaBb
AaBb
X
Ley de la independencia de los
caracteres no antagónicos.
Al cruzar los guisantes amarillos
lisos obtenidos dieron la
siguiente segregación:
9 amarillos lisos
3 verdes lisos
3 amarillos rugosos
1 verde rugoso.
De esta manera demostró que
los caracteres color y textura
eran independientes.
AB Ab aB ab
AB
AB Ab aB ab
Ab
aB
ab
AB
AA,BB
AA,Bb Aa,BB Aa,Bb
Ab
AA,Bb
AA,bb Aa,Bb Aa,bb
aB
Aa,BB
Aa,Bb aa,BB
aa,Bb
ab
Aa,Bb
Aa,bb
aa,bb
aa,Bb
Más información en :http://www.arrakis.es/~lluengo/genemende.html#GlossTercera
(i+2)
LA HERENCIA DEL SEXO
Como ya sabemos el
sexo en la especie
humana está
determinado por los
cromosomas sexuales
X e Y. Las mujeres
son homogaméticas
(XX) y los hombres
heterogaméticos
(XY). Si en el
momento de la
concepción se unen
un óvulo X con un
espermatozoide X, el
zigoto dará una mujer.
Si se unen un óvulo X
con un
espermatozoide Y,
dará una hombre.
♀ Mujer
♂ Hombre
XX
XY
X
X
XX
Y
XY
(i+5)
Las mutaciones génicas se producen cuando se altera la secuencia de
nucleótidos del gen por causas físicas (radiaciones) o químicas.
ADN original
A
T
T
A
C
G
A
G C
T
A
C
T
C
G
T
G
C
A
C
T
G
C
A
A
G C
G
T
G
Agente físico
o químico
A
T
T
A
C
G
A
G C
T
A
T
C
G
C
G
G A
T
A
T
G
A
ADN con mutación génica
C
C
G
A
T
C
G
Molécula A
Molécula B
Digestión de ambas moléculas con la
misma enzima de restricción, BamHI
Extremos
cohesivos
Mezclar
Tratar con ADN-ligasa
ADN recombinante
Clonación
molecular
Animación
http://www.sumanasinc.com/webcontent/anisamples/molecularbiology/plasmidcloning_fla.html
Plásmido
1
Virus
2
3
Animación:
http://www.sumanasinc.com/webcontent/anisamples/molecularbiology/pcr.html
Ciclo lisogénico
Ciclo lítico
(f)
(g)
(h)
Biblioteca
genómica
•Detección de mutaciones
Método de diagnóstico rutinario (relación entre enfermedad y mutación puntual)
•Secuenciación de ADNs fósiles
Posibilidad de aislar secuencias de ADN a partir de unas pocas copias (la mayoría
están dañadas o degradadas)
•Diagnóstico de enfermedades genéticas
Diagnóstico prenatal / Diagnóstico preimplantación de enfermedades hereditarias o
determinación del sexo del feto previamente a su implantación en procesos de
fecundación in vitro
•Identificación de especies y control de cruces entre animales
Para descubrir fraudes comerciales, tales como vender carne de una especie más
barata a los precios de otra más cara, o el comercio ilegal de especies en peligro
•Secuenciación de genomas
Conocimiento básico y aplicado de diferentes organismos (incluido el genoma humano)
Obtención de proteínas de interés médico, comercial, etc...
(insulina, hormona del crecimiento, factores de coagulación antes se obtenían
a partir de los tejidos que las producen o fluidos corporales)
Obtención de vacunas recombinantes
(aternativa al uso de organismos patógenos inactivos)
Extracción del ADN
del virus
Integración del
plásmido híbrido
en el núcleo de una
célula de levadura
ADN
plásmido
bacteriano
La levadura fabrica las
proteínas víricas
con poder inmunológico
Inyección de proteínas
víricas en un chimpancé
Diagnóstico de enfermedades de origen genético
Mediante ingeniería genética
se construye una sonda de
ADN, marcada (marcaje
fluorescente), con la
secuencia complementaria del
ADN enfermo
ADN sano
ADN enfermo
Conocimiento previo de
la secuencia de ADN
enfermo
Biochip
Microarray
DNAchip
ADN complementario
del ADN enfermo
DIAGNÓSTICO
Si aparecen bandas
fluorescentes
demuestra que la
persona presenta la
anomalía
¿Hibridación? Renaturalización
¿No hibridación? del ADN con la
sonda
fluorescente
Desnatura
lización
del ADN
ADN de la
persona que se
quiere
diagnosticar
Plantas transgénicas
Agrobacterium tumefaciens es patógena de plantas.Produce tumores
Agrobacterium
núcleo
Plásmido Ti
Transgénesis= introducción de
ADN extraño en un genoma, de
modo que se mantenga estable de
forma hereditaria y afecte a
todas las células en los organismos
multicelulares.
Ingeniero
genético
natural tras
sutitución de
genes onc por
genes de
interés
cromosoma
inductor de tumores
contiene oncogenes
(genes onc)
cromosoma
célula
vegetal
tumores
Proliferación de
hormonas
crecimiento. Se
forman tumores en
las zonas de la
lesión
•Resistencia a herbicidas, insectos y enfermedades microbianas
El maíz transgénico de Novartis es resistente al herbicida Basta y también es
resistente al gusano barrenador europeo (contiene el Gen de resistencia a la
toxina Bt de Bacillus thuringiensis) produce su propio insecticida
Problemas:La toxina Bt en las plantas transgénicas tiene propiedades
sustancialmente diferentes a la toxina Bt en su forma natural.
La toxina puede ser transmitida a través de la cadena alimenticia, un
efecto que nunca ha sido observado en la toxina Bt en su forma natural.
Larvas de especies de insectos predadores benéficos (larvas verdes de
crisopa) murieron cuando fueron alimentadas con el gusano barrenador
europeo
Gold rice de Monsanto con color amarillo por los altos niveles de vitamina A
Mejora de la calidad de los productos agrícolas
Producción de aceites modificados
•Síntesis de productos de interés comercial
Anticuerpos animales, interferón, e incluso elementos de un poliéster destinado a la
fabricación de plásticos biodegradables
Clonación de animales
(TRANSFERENCIA NUCLEAR DE CÉLULAS EMBRIONARIAS)
Clonación de animales
(TRANSFERENCIA DEL NÚCLEO DE UNA CELULA SOMATICA: CÉLULA DIFERENCIADA)
Clonan cerdos destinados a trasplantar sus órganos a
humanos
La empresa escocesa PPL Therapeutics logra
retirar de los cerditos el gen que provoca el
rechazo en transplantes a humanos "alfa 1,3
galactosil transferasa"
Enero 2002. AP Photo/Roanoke Times, Gene Dalton (IDEAL-EFE)
Paso importante en favor del xenotrasplante (transferencia de células u
órganos de una especie a otra)
Ayudará a superar la escasez de órganos humanos para hacer trasplantes de
todo tipo
Declaración Universal de Derecho Humanos y Genoma Humano de la UNESCO (1997),
adoptada en 1998 por la Asamblea General de ONU (busca un balance entre una
continuación en las investigaciones y la salvaguarda de los derechos humanos)
Frente a los múltiples beneficios de la ingeniería genética
pueden surgir algunos problemas
Problemas sanitarios nuevos microorganismos patógenos,
efectos secundarios de nuevos fármacos de diseño, etc...
Problemas ecológicos
desaparición de especies con consecuencias
desconocidas, nuevas contaminaciones debidas a un metabolismo incontrolado, etc...
Problemas sociales y políticos en el campo de la producción industrial, agrícola y ganadera,
pueden crear diferencias aún más grandes entre países ricos y pobres. El sondeo génico en
personas puede llevar a consecuencias nefastas en la contratación laboral, por ejemplo, y atenta contra
la intimidad a que tiene derecho toda persona (empleo, agencias de seguros, discriminación..).
Problemas éticos y morales
Poder conocer y modificar el patrimonio genético humano
puede ser una puerta abierta al eugenismo "Eugenesia: la ciencia del incremento de la felicidad humana a
través del perfeccionamiento de las características hereditarias".
Genoma de hongos: 44 millones de pares de bases
Huesped: Escherichia coli
Vector: Bacteriófagos
capacidad: 20 mil pares de bases
Genoma humano: 3000 millones de pares de bases
Huesped: Saccharomyces cerevisiae
Vector: YAC (cromosoma artificial de levadura)
MegaYAC (capacidad: 1 millón de pares de bases)
ACTTTGTCCACGGCCTAAGCGTTTTTTGCCC
Secuenciación
de genomas
AGTGACTTTGTCCAAC
GTCCAACAGTTACCAAGTGACTTTGTCCAC
TTTTGCCC
AGTGACTTTGTCCA
ACGGCCTAAGCGTTTTTTTT
ALINEAMIENTO DE TODAS LAS SECUENCIAS Y RECONSTRUCCIÓN DEL CROMOSOMA
► APLICACIONES EN MEDICINA
Las aplicaciones de la ingeniería genética en biomedicina aumentan espectacularmente. Entre ellas
destacan:
1) Fabricación de productos farmacéuticos. En la actualidad, una de las técnicas de ingeniería genética más empleada
consiste en la producción de sustancias humanas por bacterias a las que se les ha introducido el gen correspondiente. Entre
las sustancias que ya se obtienen mediante esta técnica están algunas hormonas como la insulina (Se consiguió introducir
en una bacteria el gen que codifica para la síntesis de la insulina. Esta bacteria produce Insulina humana vital para la
regulación del metabolismo de los glucidos en el organismo), hormona del crecimiento y proteínas de la sangre tienen un
interés medico y comercial enorme.
2) Terapia génica. Es un tratamiento médico que consiste en manipular la información genética de células enfermas para
corregir un defecto genético o para dotar a las células de una nueva función que les permita superar una alteración.
En principio existen tres formas de tratar enfermedades con estas terapias:
Sustituir genes alterados. Se pueden corregir mutaciones mediante cirugía génica, sustituyendo el gen defectuoso o
reparando la secuencia mutada.
Inhibir o contrarrestar efectos dañinos. Se silencia un gen que produce una proteína dañina. Para ello, se actúa sobre el
ARN mensajero, haciendo que hibride. Así la proteína no se produce.
Insertar genes nuevos. Se insertan genes suicidas que destruyen a la propia célula que los aloja o genes estimuladores de
la respuesta inmune. También se puede introducir una copia de un gen normal para sustituir la función de un gen mutante
que no fabrica una proteína correcta. Por ejemplo, en el tratamiento de los cánceres que se realiza hoy día, una de las
principales vías de investigación es la de marcar genéticamente a las células tumorales de un cáncer para que el organismo
las reconozca como extrañas y pueda luchar contra ellas, estimulando la respuesta inmune.
Otras estrategias que se siguen en la actualidad contra el cáncer son:
Inactivar oncogenes.
Introducir genes supresores de tumores.
Introducir genes suicidas.
Introducir genes que aumenten sensibilidad a fármacos.
2) Terapia génica. Es un tratamiento médico que consiste en manipular la
información genética de células enfermas para corregir un defecto genético o para
dotar a las células de una nueva función que les permita superar una alteración.
En principio existen tres formas de tratar enfermedades con estas terapias:
Sustituir genes alterados. Se pueden corregir mutaciones mediante cirugía
génica, sustituyendo el gen defectuoso o reparando la secuencia mutada.
Inhibir o contrarrestar efectos dañinos. Se silencia un gen que produce una
proteína dañina. Para ello, se actúa sobre el ARN mensajero, haciendo que
hibride. Así la proteína no se produce.
Insertar genes nuevos. Se insertan genes suicidas que destruyen a la propia
célula que los aloja o genes estimuladores de la respuesta inmune. También se
puede introducir una copia de un gen normal para sustituir la función de un gen
mutante que no fabrica una proteína correcta. Por ejemplo, en el tratamiento de
los cánceres que se realiza hoy día, una de las principales vías de investigación
es la de marcar genéticamente a las células tumorales de un cáncer para que el
organismo las reconozca como extrañas y pueda luchar contra ellas, estimulando
la respuesta inmune.
Otras estrategias que se siguen en la actualidad contra el cáncer son:
Inactivar oncogenes.
Introducir genes supresores de tumores.
Introducir genes suicidas.
Introducir genes que aumenten sensibilidad a fármacos.
El proceso de fermentación ha
sido manipulado por el hombre
de diversas formas para
obtener toda una serie de
alimentos y bebidas.
Así, por fermentación láctica
se produce queso y yogur;
la fermentación alcohólica se
emplea para la elaboración de
pan fermentado (en este caso
se aprovechan las burbujas de
dióxido de carbono para
esponjar el pan) y bebidas
alcohólicas como el vino, la
cerveza (ver figura 3), sidra,
etc.
En la fermentación alcohólica
se emplean diferentes
especies de levaduras (hongos
unicelulares) del género
Saccharomyces
Figura 3: Producción de la cerveza
La industria farmacéutica produce
actualmente toda una gama de
sustancias que obtiene de
microorganismos como son: sustancias
antimicrobianas (sobre todo
antibióticos de diversos tipos), vacunas,
vitaminas, hormonas peptídicas (como
la insulina, la hormona del crecimiento o
somatotropina), factores hipotalámicos
(como la somatostatina, ver figura) y
enzimas.
Figura 2: Síntesis de la somatostatina en
Escherichia coli
Diversos tipos de industrias utilizan microorganismos para la obtención de
sustancias de interés como aminoácidos (ácido glutámico en forma de
glutamato monosódico usado como potenciador de sabores y aromas); ácidos
orgánicos como cítrico, acético (utilizado en la fabricación de acetatos,
películas fotográficas, etc.); butanol (empleado en la fabricación de
plastificantes), etanol (como combustible), enzimas como proteasas (usadas
en detergentes), etc.
En las industrias mineras se utilizan micoorganismos para extraer por
biolixiviación metales preciosos, metales pesados, uranio y petróleo.
Diversos tipos de industrias utilizan microorganismos para la obtención de
sustancias de interés como aminoácidos (ácido glutámico en forma de
glutamato monosódico usado como potenciador de sabores y aromas); ácidos
orgánicos como cítrico, acético (utilizado en la fabricación de acetatos,
películas fotográficas, etc.); butanol (empleado en la fabricación de
plastificantes), etanol (como combustible), enzimas como proteasas (usadas
en detergentes), etc.
En las industrias mineras se utilizan micoorganismos para extraer por
biolixiviación metales preciosos, metales pesados, uranio y petróleo.
Para la protección del medio ambiente se
utilizan técnicas de biorremediación
empleando microbios que son capaces de
metabolizar el petróleo en casos de mareas
negra y en el lavado de tanques de
petroleros; así como para descontaminar
aguas residuales de diferente industrias que
contengan metales pesados, uranio,
hidrocarburos, etc.
Las técnicas biotecnológicas se aplican a la agricultura y a la ganadería para obtener
mayores cosechas y mejores alimentos con plantas y mayor cantidad y calidad en la cría
de ganado, así como evitar el fraude en el consumo de alimentos (comercializar unas
especies piscícolas por otras, alimentos transgénicos, etc.).
Se trabaja en tres líneas biotecnológicas:
a) para obtener múltiples individuos iguales con una característica que interese.
b) Modificación genética de especies con características nuevas (transgénesis)
c) Desarrollo de huellas genéticas para identificar especies o búsqueda de
genes concretos.
La clonación en plantas se consigue sobre todo mediante la manipulación de cultivos celulares.
La principal técnica empleada es la micropropagaciónn o propagación vegetativa in vitro, la cual
permite clonar en corto tiempo un gran número de especies. Este procedimiento se utiliza para la
selección y producción de plantas en grandes cantidades, así como para la investigación en biología
vegetal.
Se consigue mediante la obtención de unos
fragmentos o explantes de la planta madre.
Los explantes se colocan en un medio de
cultivo adecuado y produce un callo (masa
de células sin diferenciar); los callos pueden
dividirse en multitud de fragmentos o
incluso hacerse una suspensión de células.
En el momento que se desee, se cambian las
concentraciones de hormonas auxina y
citoquinina, esto hace que se diferencien las
células de los callos con lo que originarán
plantas enteras. Esta técnica puede ser muy
útil para la conservación de especies y
variedades en peligro de extinción, así como
para hacer más rentables la producción de
flores o de metabolitos secundarios
(perfumes, pigmentos, etc.)
Figura 4: Método de obtención de callos caulinares
Para obtener plantas trásgénicas con genes de otras especies ( sean plantas, microbios o
animales) se pueden utilizar dos grupos de técnicas: las indirectas y las directas.
La más usada es la transformación de células
mediante la bacteria Agrobacterium
tumefaciens.
Esta bacteria vive en el suelo y produce en
las plantas dicotiledóneas una enfermedad
tumoral llamada "agalla de cuello".
Cuando contacta con las células de la planta
les transfiere un segmento de ADN del
plásmido Ti (inductor de tumores) que
contiene la bacteria. Este plásmido puede
integrarse en uno o más cromosomas de las
células vegetales, por lo que puede utilizarse
como vector de genes que se deseen
introducir en plantas de especies
dicotiledóneas.
La célula que recibe genes extraños puede
regenerar una planta entera mediante la
técnica de la micropropagación y obtener así
una planta transgénica.
Figura 5: Transferencia de ADN extraño a una célula vegetal mediante el
vector bacteriano Agrobacterium tumefaciens
Vectores a partir del plásmido Ti
Suelen ser de uno de dos posibles tipos:
vectores binarios
vectores recombinativos (cointegrativos)
En esencia, hemos "vaciado" el interior del ADN-T, dejando de él sólo los
bordes (imprescindibles), y lo hemos sustituido por dos genes: uno es un
marcador para localizar o seleccionar las células que se hayan transformado;
el otro es el gen que queremos poner a trabajar en la planta.
Ahora introducimos nuestro vector (con la correspondiente construcción
genética) en una cepa de Agrobacterium a la que hemos "desarmado" su
plásmido Ti (con objeto aprovechar sus funciones de transferencia del ADN-T,
pero inactivándole sus funciones patógenas).
Ejemplo de uso: introducción del gen Bt que determina la toxina
antiiinsecticida de la bacteria Bacillus thuringiensis.
esistencia a plagas
Frente a larvas de insectos (coleópteros, lepidópteros, dípteros...):con gen Bt:, que codifica insecticida natural de especies
de Bacillus.
Frente a hongos (e insectos), usando genes vegetales que codifican enzimas hidrolíticas como quitinasa, glucanasa, etc.
Las técnicas biotecnológicas se aplican a la agricultura y a la ganadería para obtener
mayores cosechas y mejores alimentos con plantas y mayor cantidad y calidad en la cría
de ganado, así como evitar el fraude en el consumo de alimentos (comercializar unas
especies piscícolas por otras, alimentos transgénicos, etc.).
Se trabaja en tres líneas biotecnológicas:
a) para obtener múltiples individuos iguales con una característica que interese.
b) Modificación genética de especies con características nuevas (transgénesis)
c) Desarrollo de huellas genéticas para identificar especies o búsqueda de
genes concretos.
Entre las diversas técnicas de
transferencia directa de material
genético una de las más empleadas
es la "de la perdigonada" o
transformación biolística. Se trata
de disparar bolitas de oro que llevan
fragmentos de ADN adheridos, con
una especie de pistola, sobre una
población de células. Las bolitas que
queden en el citoplasma pueden
transferir el ADN que transportan a
algún cromosoma de la célula
bombardeada.
Las aplicaciones agrícolas van desde
el mejoramiento de procesos básicos
como la fotosíntesis y la fijación de
nitrógeno atmosférico por parte de
las plantas, hasta la resistencia a
herbicidas, agentes patógenos y
factores de estrés (salinidad del
suelo, sequía, etc.), así como la
obtención de productos agrícolas de
mejor calidad y características
nuevas.
Figura 6: Obtención de una planta transgénica por transformación biolística
La obtención de un gran numero de animales con alguna característica común (producir mucha leche,
engordar rápidamente, producir lana azul, etc.) es una aspiración de muchos ganaderos. La forma de
conseguirlo es mediante la clonación con la que se consiguen animales genéticamente idénticos. Se usan
para ello dos técnicas:
a) la disgregación de células embrionarias a
partir de un embrión, de modo que cada
célula separada funciona como un zigoto y
originará un animal.
b) la transferencia nuclear; ésta consiste en
obtener óvulos enucleados (se les ha extraído el
núcleo por microsucción) y conseguir introducir un
núcleo de una célula embrionaria o de una
diferenciada (especializada), con esta última
modalidad se obtuvo la famosa oveja Dolly. Cuanto
más diferenciada esté una célula más difícil es
conseguir su reprogramación para que funcione
como un zigoto y origine un nuevo animal.
Obtención de reses clónicas mediante la transferencia
de núcleos de células embrionarias de mórula
En los animales el ADN extraño o transgén se
introduce en zigotos de modo que el embrión que
resulte haya integrado el transgén en todas las células
y origine un organismo transgénico. Una forma de
conseguir la transgénesis es mediante la técnica de la
microinyección de zigotos, en la que se inyecta con una
micropipeta el material genético que se desee. Otra
posibilidad es utilizar células embrionarias en las que
se inocula el transgén mediante diversas técnicas
(electroporación, transfección con virus o por
microinyección).
Aparato de microinyección
Las aplicaciones son múltiples, como con las plantas,
desde el uso de animales como biorreactores para la
producción de proteínas de interés (humanas o de otro
tipo), hasta el estudio de genes específicos y la
posibilidad de la terapia génica en humanos.
Cuando el ADN extraño que se introduce no afecta a
células germinales, sino a las células somáticas, se
denomina al proceso tranfección y para conseguirla se
usan distintas técnicas. Las células transfectadas tienen
gran interés en la obtención de líneas celulares alteradas
capaces de producir compuestos comerciales.
Fases en la transfección de ADN según diversas técnicas
Este proyecto de investigación tiene como objetivo
averiguar la secuenciación completa de nucleótidos
de los 23 pares de cromosomas humanos, para
conocer la composición química exacta de todos los
genes (genoma) y su ubicación en cada uno de los
cromosomas, así como toda la información adicional
extra no codificante (el llamado ADN basura) y
estudiar su función.
En 1997, el Genoma humano fue declarado
patrimonio de la Humanidad por la UNESCO, para
evitar que se comercialice con él. En junio del año
2001 se presenta una primera aproximación de la
secuencia completa, descubriéndose que tenemos
muchos menos genes (unos 30.000) de los
inicialmente previstos (100.000).
Ubicación de algunas enfermedades genéticas
conocidas en el mapa genético humano
Las enfermedades genéticas debidas a un solo gen defectuoso ascienden a más de
4000, de las cuales 345 afectan al cromosoma X, por lo que serán transmitidas a los
niños varones, si su madre posee uno de esos defectos genéticos.
La terapia génica está siendo considerada la cuarta revolución de la medicina
(después de las medidas de salud pública, la anestesia, y las vacunas y antibióticos).
Para su aplicación se siguen dos estrategias:
a) Insertar una copia sana de un gen en las células del paciente con una
enfermedad genética, para compensar el efecto del gen defectuoso ( esto se
consiguió con una niña que tenía una inmunodeficiencia grave).
b) Introducir un gen especialmente diseñado para que proporcione una nueva
característica a las células (por ejemplo, introducir en linfocitos un gen que
produzca un inhibidor del virus del sida en pacientes afectados por el VIH).
Las vacunas contienen un agente patógeno causante de una enfermedad infecciosa, pero o
está muerto o está atenuado (son cepas muy poco virulentas). También se puede vacunar con
subunidades del patógeno, éstas pueden hoy día fabricarse mediante ingeniería genética en
gran cantidad. Las subunidades son proteínas con poder antigénico. Así, se ha conseguido
obtener la vacuna de la hepatitis B mediante la tecnología del ADN recombinante. El gen de la
subunidad proteica del virus de la hepatitis fue introducido en la bacteria Escherichia coli y en
la levadura Saccharomyces cerevisiae, las cuales produjeron en cultivo la proteína del virus.
Los anticuerpos sirven como defensa frente a enfermedades infecciosas y sustancias extrañas,
pero además son un medio de curación para aquellos enfermos que no son capaces de
producirlos.
La técnica de los anticuerpos monoclonales permite obtener gran cantidad de ellos y sin
impurezas; consiste en inmortalizar las células responsables de su fabricación, las células
plasmáticas que se forman por activación de los linfocitos B. La forma de conseguirlo es
hibridando células plasmáticas y células tumorales con capacidad para multiplicarse
indefinidamente (células de mielomas), el resultado son células híbridas llamadas hibridomas
que se pueden clonar. Cada clon (procedente de un solo hibridoma) producirá un anticuerpo
monoclonal.
La biotecnología se puede aplicar a otras facetas de la vida social además de las mencionadas. De entre todas
ellas es de destacar su utilización en relación con el derecho y la ciencia forense.
En el esclarecimiento de un crimen puede ser crucial la
prueba que aporte el biólogo forense al determinar la huella
genética del criminal a partir de un resto de saliva en un
cigarrillo (contiene células de la mucosa bucal), una mancha
de sangre (leucocitos), restos de semen (espermatozoides)
o un simple pelo (células del folículo piloso). La técnica que
se aplica es la del perfilado del ADN o prueba del ADN . Se
basa en la presencia de regiones en el material genético no
codificante que se denominan minisatélites , y que contienen
muchas repeticiones en tándem de una pequeña secuencia de
nucleótidos. Para su detección se utilizan sondas génicas
(oligonucleótidos marcados con átomos radiactivos), de modo
que cada sonda detecta un minisatélite. Estos minisatélites
son de diferente longitud en cada persona puesto que el
número de repeticiones en tándem es variable.
La huella genética también puede utilizarse para realizar
pruebas de paternidad y para identificar a personas
desaparecidas de las que se tengan sus huesos; esto ocurrió
con los restos óseos de los miembros de la familia del último
zar de Rusia asesinados por los bolcheviques.
Técnica utilizada en la prueba del ADN
Descargar

Diapositiva 1