Síntesis de proteínas
Capacitación – Zona de Río Piedras
3 de noviembre de 2007
Algunas proteínas de uso clínico
hechas en PR
 Abbott (Barceloneta)
 Humira®- Bloqueador de “Tumor Necrosis Factor”
 artritis
 Amgen (Juncos)
 Epogen®- eritropoietina
 Anemias
 Eli Lilly (Carolina)
 Humulin®- Insulina
 Diabetes
 Wyeth (Carolina)
 Prevnar®- “Diphtheria CRM197 Protein”
 Vacuna en contra de infecciones de pneumococos
¿Cómo la célula hace
proteínas?
nucleotidos
transcripcion
Polimerasa de RNA
mRNA
rRNA
tRNA
traduccion
ribosoma
Amino acidos
Dogma
Central de la
Biología
Molecular
ADN
ARN
Proteín
a
Característica
Kit de
Transformación
de Bacteria
con plásmido
pGLO™
Proteínas y Biotecnología
De ADN a proteína
Flujo de la información genética
En una molécula de ADN se encuentran muchos genes. Un gene es una secuencia
de nucleótidos que contiene información para un producto (inf. en región
codificadora) e información que indica en qué tejido y cuándo se va a expresar el
gene (inf. en promotor y amplificador) .
Unidad transcripcional
Relación de RNA con las
cadenas del DNA
Fig. 5.2 Chemical reaction involved in the RNA polymerase-catalyzed synthesis of
RNA on a DNA template strand
Actividad: Dramatización del proceso
de traducción
Paso 1: Transcripción
3’ TACCAAGTAGAATGAGGAGTTGTCTTTTCACGACAGTGGCGGGAG
ATACCATTCCATTTACACTTGGTTCAACCGCCTGTTCGTAATCCA
GCAAACATC 5’
Actividad: Dramatización del proceso
de traducción
Paso 1: Transcripción
3’ TACCAAGT AGAATGAGGAGTTGTC T T T TCACGACAGTGGCGGGAG
5’ AUGGUUCAUCUUACUCCUCAACAGAAAAGUGCUGUCACCGCCCUC
ATACCAT T CCAT T TACACTTGGT T CAACCGCCTGT T CGT AATCCA
UAUGGUAAGGUAAAUGUGAACCAAGUUGGCGGACAAGCAUUAGGU
GCAAACATC 5’
CGUUUGUAG3’
Actividad: Dramatización del proceso
de traducción
Paso 2: Identificar codones
3’ TACCAAGT AGAATGAGGAGTTGTC T T T TCACGACAGTGGCGGGAG
5’ AUGGUUCAUCUUACUCCUCAACAGAAAAGUGCUGUCACCGCCCUC
ATACCAT T CCAT T TACACTTGGT T CAACCGCCTGT T CGT AATCCA
UAUGGUAAGGUAAAUGUGAACCAAGUUGGCGGACAAGCAUUAGGU
GCAAACATC 5’
CGUUUGUAG3’
Pasos en la traducción
Actividad (cont…)
 Asignar las figuras de los tARN’s
 Cada estudiante


encuentre en la mesa los amino ácidos que
corresponden a su tARN
unan el amino acido al tARN con cinta
adhesiva.
Actividad:
Paso 3: Leer el mARN por el
ribosoma
5’ TACCAAGT AGAATGAGGAGTTGTC T T T TCACGACAGTGGCGGGAG
3’ AUGGUUCAUCUUACUCCUCAACAGAAAAGUGCUGUCACCGCCCUC
ATACCAT T CCAT T TACACTTGGT T CAACCGCCTGT T CGT AATCCA
UAUGGUAAGGUAAAUGUGAACCAAGUUGGCGGACAAGCAUUAGGU
GCAAACATC 3’
CGUUUGUAG5’
Preguntas para discutir
 Compara y contrasta un codón y un anti-codón.
 Explica la relación entre el código genético y los codones.
 De acuerdo a la actividad, ¿que características puedes




atribuirle al código genético?
¿Qué relación hay entre la secuencia de bases en el ARN y la
secuencia de aminoácidos en el polipéptido?
Explica el rol del ribosoma y los tARN’s en el proceso de
traducción
Si en la secuencia de bases del ARN mensajero no se
encuentra el codón AUG ¿qué ocurrirá?
Explica que sucede si el segundo codón en el ARN se
sustituye por:
 AUG
 UAA
 UGG
Actividad de assessment
 Realiza un dibujo de un modelo de célula
eucariota y una procariota. Señala en cada
una de éstas donde ocurren los procesos de
transcripción y traducción.
Descargar

Document