T
R
A
D
U
C
C
I
Ó
N
T
R
A
D
U
C
C
I

N
RELACIONES
TRADUCCIÓN
•Transferencia de información del lenguaje de los
nucleótidos al de los aminoácidos
•la información del ADN es transportada por el ARN-m
Elementos que intervienen en la
traducción
• RNA-m, RNA-t.
• Ribosomas. RNA-r
• Enzimas: Aminoacil RNA-t sintetasa, translocasas,
peptidasas
• Una fuente de energía como nucleótidos trifosfato
(GTP y ATP).
• factores de iniciación y terminación.
factor RF1 reconoce los codones UAA y UAG, el
factor RF2 identifica a los codones UAA y UGA.
factor RF3 también colabora en la reacción de
terminación.
• Aminoácidos
Proceso de traducción
1º activación de los aminoácidos y formación
de los complejos de transferencia:
- Los aminoácidos por sí solos no son capaces
de reconocer los tripletes del ARN-m de
manera que necesitan unirse a un ARN de
pequeño tamaño (K de sedimentación 4S)
llamado ARN adaptador, ARN soluble o ARN
transferente
• El que realiza el reconocimiento del codón
correspondiente del ARN-m es el anticodón
del ARN-t y no el aminoácido.
2º Las proteínas de los seres vivos se fabrican
en los RIBOSOMAS asociados al retículo
endoplasmático.
•Los ribosomas son
nucleoproteínas, algo
similar a la propia
cromatina nuclear, con
la particularidad de
que están formados
por una asociación de
proteínas y un RNA
especial que es el
llamado RNAribosómico.
En la traducción intervienen
• RNA-mensajero (RNA-m): es el encargado de
transportar la información genética desde el
núcleo hasta los ribosomas con el fin de que
pueda ser expresada en forma de proteínas.
• RNA-ribosómico (RNA-r): forma parte esencial
de las dos subunidades que constituyen los
ribosomas.
• RNA-transferente (RNA-t): juega un papel
fundamental transportando a los aminoácidos
hasta los ribosomas en el orden correcto en que
deben unirse para formar una proteína
determinada, según la información genética.
ARNm o ARN Mensajero
El ARN- m: estructura diferente en procariotas y en
eucariotas.
En eucariótas tiene zonas con sólo estructura 1ª
(una sola hebra), y zonas con estructura 2ª de doble
hélice, que dan lugar a los llamados lazos en
herradura. Se encuentra asociado a proteínas.
- Se forman por maduración en el núcleo a partir
del ARN-hn.
- Posee en su extremo 5' una estructura que recibe
el nombre de "caperuza“ que bloquea la acción de
enzimas y constituye la señal de inicio en la síntesis
de proteínas. A continuación hay un segmento sin
información, seguido de otro extremo con
información que empieza con la secuencia A-U-G.
En el extremo 3' o extremo final posee de 150 a 200
nucleótidos de adenina, lo que se denomina "cola"
de poli A.
El ARNm procariótico no adopta la estructura del
ARN eucariótico, carece de caperuza y de la cola de
poli-A.
Los RNA-t
3'
5'
• Cadenas cortas de ribonucleótidos
arrolladas en el espacio de tal forma
que se produce apareamiento entre
bases complementarias que quedan
próximas. Presentan una
configuración espacial en forma de
"hoja de trébol", con cuatro bucles de
RNA no apareado que cumplen
diferentes funciones:
• BRAZO ACEPTOR, formado por los
extremos 3' y 5' de la cadena que se
encuentran próximos. En el extremo
5' es donde se unirá el aminoácido
que debe ser transportado hasta el
ribosoma.
• BRAZO AMINOACIL RNA-t
SINTETASA o TFIC, que interacciona
con la enzima que va a unir al RNA-t
con su aminoácido específico.
• BRAZO ANTICODÓN: zona donde el
RNA-t se une a un aá específico,
según la secuencia de cada codón
del RNA-m. Es la secuencia de 3 BN
complementaria de un codón o
triplete de bases de un RNA-m.
ARNr o ARN Ribosómico
El ARN-r se encuentra en los ribosomas. Este tipo de ARN constituye el 60% del
peso de dichos orgánulos, lo que representa el 80% del total del ARN celular.
El ARNr presenta segmentos lineales y segmentos en doble hélice (estructura
secundaria), debido a la presencia de secuencias complementarias de
ribonucleótidos a lo largo de la molécula.
Además, el ARNr presenta una estructura terciaria al asociarse con las proteínas
ribosómicas. Esta estructura terciaria está relacionada con la síntesis de
proteínas, ya que proporciona a los ribosomas la forma adecuada para dar
alojamiento a un ARNm (en rojo, en la imagen de la izquierda) y a los
aminoácidos que forman las proteínas durante dicho proceso.
Activación de aminoácidos:
• Cada RNA-t busca a su aminoácido específico
según el triplete de su anticodón y se une a él
por la acción de una enzima específica llamada
aminoacil RNA-t sintetasa, que une al
aminoácido con su RNA-t en el brazo aceptor,
gastándose una molécula de ATP. De este
modo, un gran número de transferentes se
encuentran unidos a su aminoácido antes de
iniciarse la traducción.
Etapas del proceso de
traducción
Iniciación
Elongación
Terminación
Iniciación:
• Las subunidades ribosomales están separadas cuando
no están ocupadas en la síntesis de polipéptidos. Para
poder iniciar la traducción es necesario que ambas
subunidades se ensamblen.
• El RNA-m llega hasta el ribosoma y se une a la
subunidad mayor; a continuación se une la subunidad
menor.
• En los ribosomas existen dos sitios en los que pueden
caber transferentes, el LUGAR P (peptidil) y el LUGAR A
(aminoacil).
• El RNA-m se une de tal forma que el primer codón se
coloca en el lugar P. Este primer codon siempre es
(salvo en algunas mitocondrias), el AUG leído desde el
extremo 5', con el que se inician todos los procesos de
traducción celular y que codifica para el aá Metionina,
Iniciación traducción
•A continuación llega hasta ese lugar P un RNA-t con el aá
Metionina, y al lugar A llega otro RNA-t con el siguiente aá
que corresponda, según las bases del segundo triplete. En
ese momento una enzima une ambos aminoácidos
mediante un enlace peptídico y todo el complejo se
desplaza un lugar hacia el primer codón, de tal manera que
ahora el dipéptido se coloca en el lugar P (peptidil) y queda
libre el lugar A (aminoacil).
Elongación:
• Al quedar libre el lugar
aminoacil se acerca un
nuevo RNA-t, según la
secuencia de su
anticodón, trayendo
un nuevo aá,
volviendo a crearse un
enlace peptídico y
repitiéndose el
desplazamiento del
complejo. Estos
procesos se repiten
siempre que el codón
que aparece en el lugar
A tenga sentido.
Terminación de la cadena
polipeptídica
• En un momento
determinado puede
aparecer en el lugar A uno
de los codones sin sentido
o de terminación: UAA,
UAG, UGA, con lo que no
entrará ningún nuevo
RNA-t y el péptido estará
acabado, desprendiéndose
del anterior RNA-t y
liberándose al citoplasma
al tiempo que los
ribosomas quedan
preparados para iniciar
una nueva traducción.
• La nueva cadena va adquiriendo su estructura secundaria
y terciaria a la vez que se va formando, de tal manera que
al finalizar ya tiene su conformación En ocasiones la
proteína no es todavía funcional y debe ser procesada,
añadiéndole algo, recortándole algo o, incluso, debe unirse
a otros péptidos para adquirir estructura cuaternaria
Qué aprendí???...
1.- Escribe la secuencia complementaria en
dirección 5’ 3’
a) 5’- GATCAA- 3’
b) 3’- ACTGGCCTAA -5’
c) 5’- ACCTAGGGTA -3’
d) 3’- CCTGGATTAAG -5’
2.- Cuantos aminoácidos pueden ser
codificados de las siguiente secuencia de
mARN.
a) Asumiendo que comienza la lectura en el
extremo 5’ inmediatamente.
b) Comenzando en forma normal establecida
por el código genético.
2. 12. 22. 3-
5’- UUGCCUAUGGAUUGGAUG-3´
3’-AUGUAGGUAAAGGUAGGCC-5’
3’- AGCGCCAGUGACCAUGUA-5’
Los RNA-transferentes V/F
• Interviene en la transcripción genética
Posee una secuencia de tres bases deniminada
"codón"
Es una molécula de elevado peso molecular
Cada transferente es específico de un aminoácido
• Los transferentes sólo se dan en las células eucarióticas
• Los transferentes sólo se dan en las células eucarióticas
• Posee zonas donde se aparean bases complementarias
• La tercera base del anticodón es una base rara
• Dada la siguiente cadena de ADN:
TACGGCATAGAGTCGATTGCGTAG
a) Construir su cadena complementaria.
b) Construir el ARN-m de la transcripción de la cadena.
c) Construir la proteína resultante de la traducción de ese ARN-m,
utilizando el código genético.
Descargar

Diapositiva 1