DNA
in molecular biology
(theory and practice)
by Jean-Pierre Herveg and a lot of friends at
the Brussels Branch of the Ludwig Institute for Cancer research (Licr) and the Christian de Duve*
Institute for cellular Patholgy (ICP).
April 2006
Université Catholique de Louvain
Avenue E. Mounier, 1200 Brussels (Belgium)
---------------------*Christian de Duve got the Noble Prize in medicine in 1974. He and his team discovered
both lysosomes and peroxysomes.
Questions:
1.
2.
3.
4.
5.
6.
7.
8.
9.
10.
11.
12.
13.
14.
15.
16.
what is an organism ?
what is the main difference between Procaryotes and Eucaryotes ?
what does dipolid mean ?
does a mitochondrion contain a DNA molecule ?
what’s a pluripotent cell ?
what is the meaning of dsDNA, ssDNA ?
what is the length of the period, of the diameter of a dsDNA ?
what is the distance between two nucleotides in a dsDNA molecules ?
why did Rosalind Franklin use X-rays instead of ordinary light to study DNA
how did you get a DNA sequence ?
what’s a nick, a gap, an SNP and a palindrome ?
cite two intercalating agents.
what does a mismatch do on the fusion curve.
is it possible to use the fusion curve to detect a mutation ?
what‘s a gamma phosphate in ATP
what are the best hybrids DNA/DNA or DNA/RNA ?
DNA: plan
What is an organism ?
phylogenic tree
procaryotes and eucaryotes
DNA and X-diffraction: Rosalind Franklin
The rules of Chargaff
DNA density and temperature: rené Thomas.
the so called "Watson and Crick" hypothesis.
How to get a DNA sequence from a databank
description of a DNA sequence.
ssDNA, dsDNA, a nick, a gap, a mismatch, a SNP, a palindrome, a SNP within a palindrome
DNA structure: nucleotides, nitrogenous bases, diester bonds, hydrogen bonds,
fusion and denaturation
Labelling: random priming, nick translation, polynucleotide kinase.
Hydrization
DNA preparation and purification:
short strands: phenol chloroforme, kits,
long strands: agarose plugs
DNA concentration mesurements and purity checking
euchromatine and heterochromatine
the use of BLAST (Basic Local Alignment Search Tool )
---------------------------¡ Pronunciación en ingles !:
DNA:
Usted debe pronunciar di-en-e, y no di-enne-e. En inglés, la letra n se pronuncia en, no enne
ssDNA and dsDNA: single strand and double strand DNA.
SNP: pronouce snip.
What is an organism ?
All the organisms are able to make
replication
transcription
translation
Using their own machinery
(a virus is not an organism, it needs a host do do those tasks)
Then, all the organisms are able to synthetise proteins
And shoud possess the ribosome machinery. In the small unit of any ribosome is an
RNA sequence which is known as the Small Subunit ribosomal RNA sequence or (SSU rRNA
Sequence). Every organism has a SSU rRNA sequence.
Comparing SSU sRNA from organism to organism allows the measurement of evolutionary
Distance between organism.
So a phylogenic tree can be constructed.
________________________________________
question:
What is an organism
This is a current phylogenetic tree based
on small-subunit (SSU) rRNA sequences of
the organismsrepresented.
The construction of such a tree is
conceptually simple. Pairs of rRNA sequences from
different organisms are aligned, and the
differences are counted and considered to
be some measure of"evolutionary distance”
between the organisms (NormanR. Pace, in
Science vol:276, 2 May 1997 p 735)
Procaryotes and eucaryotes (karuon: nucleus)
Procaryotes:
Organisms without nucleus: replication, transcription, and tanslation take place in a unique
Compartment. We divide the Procaryote into Bacteria and Archaea.
Eucaryotes:
Organism in which replication and transcrition takes place in a specific compartment: the nucleus.
The content of the nucleus is separated from the cytoplasm, where translation take
place, by a nuclear envelope. The nuclear envelope has ribosomes on the outside; its lumen
communicate with the lumen of the endoplasmic reticulum as you can see below:
-------------------------Question:
What is the main difference between
Procaryotes and Eucaryotes
reproduction
Ploidy indicates the number of copies of the basic number of chromosomes.
The number of basic sets of chromosomes in an organism is called the monoploid
number (x).
The ploidy of cells can vary within an organism. In humans, most cells are diploid
(containing one set of chromosomes from each parent), though sex cells
(sperm and oocytes) are haploid. In contrast, tetraploidy (four sets of chromosomes),
a type of polyploidy, is not uncommon in healthy plant species.
Euploidy, or the euploid number, is a species' normal number of chromosomes per cell.
For example, the euploid number of chromosomes in a human cell is 46.
Asexual reproduction, is the biological process by which an organism creates
a genetically-similar or identical copy of itself without a contribution of genetic
material from another individual. The division of a bacterial cell into two daughter cells
is an example of asexual reproduction. Plants have the ability to reproduce asexually.
Sexual reproduction is a biological process by which organisms create descendants
that have a combination of genetic material contributed from two (usually) different
members of the specie.
---------------------Question:
What does dipolid mean ?
Mitochondrion and chloroplasts
A mitochondrion (plural mitochondria) is an organelle found in
most eukaryotic cells. Mitochondria are sometimes described as "cellular power plants,”
because their primary function is to convert organic materials into energy in the form
of ATP via the process of oxidative phosphorylation. Usually a cell has hundreds or
thousands of mitochondria, which can occupy up to 25% of the cell's cytoplasm.
Mitochondria usually have their own DNA, and, according to the generally accepted
Endosymbiotic theory, they were originally derived from external organisms.
Chloroplasts are organelles found in protists, plant cells and eukaryotic algae
that conduct photosynthesis. Chloroplasts capture light energy from the sun to
produce the free energy stored in ATP and NADPH through a process called
photosynthesis. The fluid within the chloroplast is called the stroma, corresponding
to the cytoplasm of the bacterium, and contains tiny circular DNA and ribosomes,
though most of their proteins are encoded by genes contained in the cell nucleus,
with the protein products trafficked to the chloroplast.
Mitochondria and chloroplasts contains both DNA and ribosomes. Most of their proteins
However are encoded by genes contianed in the nucleus. It is also well known that
chloroplasts and mitochondria donated many genes to nuclear chromosomes during
Evolution (horizontal or lateral gene transfer).
-----------------------Question
Does a mitochondrion contain a DNA molecule ?
Cellular differentiation
Cellular differentiation is a concept from developmental biology describing
the process by which cells acquire a "type". The morphology of a cell may change
dramatically during differentiation, but the genetic material remains the same,
with few exceptions (gametes).
A cell that is able to differentiate into many cell types is known as pluripotent.
These cells are called stem cells in animals and meristematic cells in higher plants.
A cell that is able to differentiate into all cell types is known as totipotent.
In mammals, only the zygote and early embryonic cells are totipotent,
while in plants, many differentiated cells can become totipotent with simple
laboratory techniques.
-------------------------Question
What’s a pluripotent cell ?
Rosalind Franklin: X-rays
Rosalind Franklin (1920-1958) used X-ray diffraction to study DNA
X-rays pass through the DNA molecules and bounce off atoms diffracting in different directions.
The Diffrated X-rays leave a pattern on a photographic film
aimed X-ray at
a vertically suspended
fiber the thickness
of a single hair
Rosalind Franklin
In 1962, Maurice Wilkins, James Watson, and Francis Crick, received the Nobel prize,
leaving out any mention of Rosalin Franklin whose vital basic work on the double helix theory - a proving
photograph - was stolen by Wilkins and given to Watson and Crick. Franklin had conveniently died at 37
to end that controversy. She died of an ovary cancer.
Rosalind Franklin falleció en 1958, a los 37 años, víctima de un cáncer en los ovarios.
Su invaluable aportación a este descubrimiento no ha sido nunca reconocido ni en vida
de la cristalógrafa ni de manera póstuma… unque poco a poco se empieza a conocer su historia.
Diffraction is the apparent ``bending'' of light waves around obstacles in its path
http://theory.uwinnipeg.ca/physics/light/node7.html.
This bending is due to Huygen's principle
This principle states that all points along a wave front act as if they were point sources.
Thus, when a wave comes against a barrier with a small opening (a slit),
all but one of the effective point sources are blocked, and the light coming through
the opening behaves as a single point source, so that:
the light emerges in all directions, instead of just passing straight through the slit.
or sizeable diffraction effects to occur the width of the opening must be of the same
order or less than the wavelength of the light used.
Young's Double Slit Experiment
This is a classic example of interference effects in light waves.
Two light rays pass through two slits, separated by a distance d and
strike a screen a distance, L , from the slits
if d < < L then the difference in path length r1 - r2 travelled by the two rays is approximately:
r1 - r2 ± d sin q
If the rays were in phase when they passed through the slits,
then the condition for constructive interference at the screen is:
dsinq = ml , where m = ±1, ±2,...
whereas the condition for destructive interference at the screen is:
dsinq = (m +.0.5 )q ,m = ±1, ±2,...
The points of constructive interference will appear as bright bands on the screen and
the points of destructive interference will appear as dark bands.
These dark and bright spots are called interference fringes. Note:
Rosalind Franklin got her best results with hydrated DNA
obtained from calf thymus DNA.
aimed X-ray at
a vertically suspended
fiber the thickness
of a single hair
The cross or “X structure”
The laws of diffraction hold that X-ray moving through a helical shape diffract
at angle perpendicaular to the helix creating an X-shaped diffraction pattern
The 4 diamonds
They show the repetition of the X pattern. This indicate the presence of a huge
number od DNA strand in the fiber being analyzed
The missing smears
In the two layer 4, above and below, the right and left smears are missing.
This suggest structure is a Double helix.
The two strand cross each other and cancel each other out. This also indicates the
existence of a minor grove.
-------------------------------questions:
1. what is the meaning of dsDNA, ssDNA ?
2. what are the period, diameter of a dsDNA ?
3. what is the distance between two nucleotides in a dsDNA molecules ?
4. Why did Rosalind Franklin use X-rays instead of ordinary light to study DNA ?
Rules of Chargaff
1.
parity rule
he identified a species-invariant component of the base composition
%A = %T
and
%C = %G
5‘ tatctggttgatcctgccagtattatatgctgaattcagagattaagccatgcatgtgta 3‘
3‘ atagaccaactaggacggtcataatatacgacttaagtctctaattcggtacgtacacat 5‘
2.
GC rule
3.
4.
ratio of C + G to the total bases (A+C+G+T) tends to be constant in a particular species
but varies between species
DNA density and temperature
THOMAS, R., "The denaturation of DNA.", Gene 135, (1993) 77-7
The so* called “Watson and Crick” postulate which takes into account
the following discoveries:
1.
2.
3.
4.
the diffraction pattern obtained by Rosalind Franklin on wet and dry DNA preparations.
helical shape
An MRC* confidential report—in which Franklin had not only said that the phosphates
are on the outside of the DNA molecule but, she made measurements of the interphosphate
distances.
The rules of Chargaff: complementarity
The changes in density of DNA solution vs temperature: hydrogen bridges (this was published
in French and “rediscovered” by an American whowas able to read French.
* The “Watson and Crick” hypothesis is the first scientific misconduct.
--------------------------to postulate: postular
Helix: nf, hélice
take into account : tomar en cuenta
diffraction pattern: patrón de difracción
wet, adj (wetter, wettest): mojado,-a: mi chaqueta está mojada (una cosa) empapado,-a
dry, adj, seco
to guess
1. adivinar: guess what's happened!, ¡adivina lo que ha pasado!
2. familiar suponer: I guess not, supongo que no
backbone, nombre: columna
outside, adverbio: fuera, afuera
inside, adverbio: dentro, adentro
MRC mean Medical Research Coucil (in the UK)
she guessed right/wrong, acertó/no acertó
5‘ tatctggttgatcctgccagtattatatgctgaattcagagattaagccatgcatgtgta 3‘
3‘ atagaccaactaggacggtcataatatacgacttaagtctctaattcggtacgtacacat 5‘
........./........./........./........./........./........./
10
20
30
4O
50
60
The DNA molecule is one helix made of two helical strands
The two strands are anti parallel and bind to each other
by Hydrogen bounds.
2 x 10 nt = 10 bp by turn (por espira)
Get a DNA sequence
ncbi: national center for biotechnology informations
nlm: national library of medicine
nih: national institutes od health
gov: US government
Learn how tu use PubMd: http://www.nlm.nih.gov/bsd/disted/pubmed.html
------------------------------Question:
How did you get a DNA sequence ?
SSU: Small subunit
EDISSSURR (1212896): E. Dipar SSU rRNA
accession number: Z49256
-------------------------search for: buscar
accession: nf adquisición
record (nombre): (aquí) documento, archivo
LOCUS
DEFINITION
ACCESSION
EDISSSURR
1949 bp
DNA
linear
E.dispar gene for small subunit ribosomal RNA.
Z49256
http://www.ncbi.nlm.nih.gov/entrez/query.fcgi
1 tatctggttg atcctgccag tattatatgc
61 agtataaaga ccaagtagga tgaaactgcg
121 tggttagtaa agtacaagga tagctttgtg
181 atttgtatta gtacaaagtg gccaatttat
241 gagttaggat gccacgacaa
10 nucleotides
tgatgttaga
gacggctcat
aatgataaag
gtaagtaaat
INV 01-MAR-1996
gattaagcca
tataacagta
ataatacttg
tgagaaatga
tgcatgtgta
atagtttctt
agacgatcca
cattctaagt
2 strands antiparallel (2 cadenas antiparalelas)
5‘ tatctggttgatcctgccagtattatatgctgaattcagagattaagccatgcatgtgta 3‘
3‘ atagaccaactaggacggtcataatatacgacttaagtctctaattcggtacgtacacat 5‘
upstream
downstream
5‘ tatctggttgatcctgccagtattatatgctgaattcagagattaagccatgcatgtgta 3‘
3‘ atagaccaactaggacggtcataatatacgacttaagtctctaattcggtacgtacacat 5‘
downstream
upstream
5’
5’
------------------------upstream:
Compound Forms:
swimming upstream v: nadar contra la corriente
upstream water: aguas arriba
downstream adverbio
río abajo: the raft floated downstream, la balsa flotó río abajo
description of a sequence
(longitud de una secuencia nt o bp):
ssDNA (single strand DNA,): nt
5‘ tatctggttgatcctgccagtattatatgctgaattcagagattaagccatgcatgtgta 3‘
Length: 6O nucleotides (nt); 60 nt
dsDNA (double strand DNA): bp
5‘ tatctggttgatcctgccagtattatatgctgaattcagagattaagccatgcatgtgta 3‘
3‘ atagaccaactaggacggtcataatatacgacttaagtctctaattcggtacgtacacat 5
Length: 6O base pair (bp); 60 bp
The molecular weight of a sequence is n x 632 n is its length in bp
------------------------Single, adjetivo
1 solo,-a, único,-a: I see her every single day, la veo todos los días sin excepción
2 (cama, habitación, etc) individual
3 soltero,-a, -girlnf: chica soltera, -man nm: hombre soltero -person nf : persona soltera
4 Tip (interlineado) sencill
double, adjetivo
doble
strand, nombre
1 frml playa
2 (de hilo) hebra a strand of hair, un pelo
3 tendencia
molecular weight nm: peso molecular
length, nombre:(espacio, línea) longitud, largo:
the river is a hundred miles in length, el río mide cien millas de largo
nick
DNase is an enzyme.
DNase hydrolyses ester bounds inside a strand. It creates a nick.
In a nick there is a free 3’ OH and phosphate esterifying the OH of the next 5’ carbone.
A nick can be repared by an enzyme calles ligase. Ligase uses ATP to do its job.
Cuando la ADNase (DNase) hidroliza un enlace fosfodiéster internos de una cadena
ella forma un “nick”, liberando una extremidad hidroxilo 3’ y un radical fosfato 5’.
5‘ tatctggttgatcctgccagtattatatgctgaattcagagattaagccatgcatgtgta 3‘
3‘ atagaccaactaggacggtcataatatacgacttaagtctctaattcggtacgtacacat 5‘
a gap
5‘ tatctggttgatcctgcc
gaattcagagattaagccatgcatgtgta 3‘
3‘ atagaccaactaggacggtcataatatacgacttaagtctctaattcggtacgtacacat 5‘
5‘ tatctggttgatcctgcc 3‘
5‘gaattcagagattaagccatgcatgtgta 3‘
3‘ atagaccaactaggacggtcataatatacgacttaagtctctaattcggtacgtacacat 5‘
A mismatch
5‘ tatctggttgatcctcccagtattatatgctgaattcagagattaagccatgcatgtgta 3‘
3‘ atagaccaactaggacggtcataatatacgacttaagtctctaattcggtacgtacacat 5‘
------------------------------------------------gap [gæp] nombre
1 espacio, hueco: there was a gap in the fence, había un hueco en la valla
(en un texto) espacio en blanco:
leave a gap for personal details, deje un espacio para datos personales
2 (en el tiempo) intervalo
3 (en los conocimientos) laguna
4
(diferencia) distancia, brecha: we have to narrow the gap that exists between them,
5
tenemos que estrechar la distancia que media entre ellos
5
vacío: he left a gap that will be difficult to fill, dejó un vacío que será difícil de llenar
mismatch
1 verbo transitivo emparejar mal
2
nombre unión mal hecha, desajuste:
that couple is a real mismatch, esa pareja no casa en absoluto
SNP: Single Nucleotide Polymorphisme
5‘ tatctggttgatcctgccagtattatatgctgaattcagagattaagccatgcatgtgta 3‘
3‘ atagaccaactaggacggtcataatatacgacttaagtctctaattcggtacgtacacat 5‘
5‘ taactggttgatcctgccagtattatatgctgaattcagagattaagccatgcatgtgta 3‘
3‘ attgaccaactaggacggtcataatatacgacttaagtctctaattcggtacgtacacat 5‘
5‘ tagctggttgatcctgccagtattatatgctgaattcagagattaagccatgcatgtgta 3‘
3‘ atcgaccaactaggacggtcataatatacgacttaagtctctaattcggtacgtacacat 5‘
5‘ tacctggttgatcctgccagtattatatgctgaattcagagattaagccatgcatgtgta 3‘
3‘ atggaccaactaggacggtcataatatacgacttaagtctctaattcggtacgtacacat 5‘
-------------------------Question:
What’s a nick, a gap, an SNP and a palindrome.
Palindrome
5‘ tatctggttgatcctgccagtattatatgctgaattcagagattaagccatgcatgtgta 3‘
3‘ atagaccaactaggacggtcataatatacgacttaagtctctaattcggtacgtacacat 5‘
5‘ tatctggttgatcctgccagtattatatgctgaattcagagattaagccatgcatgtgta 3‘
3‘ atagaccaactaggacggtcataatatacgacttaagtctctaattcggtacgtacacat 5‘
a SNP within a palindrome
5‘ tatctggttgatcctgccagtattatatgctgaattcagagattaagccatgcatgtgta 3‘
3‘ atagaccaactaggacggtcataatatacgacttaagtctctaattcggtacgtacacat 5‘
5‘ tatctggttgatcctgccagtattatatgctgtattcagagattaagccatgcatgtgta 3‘
3‘ atagaccaactaggacggtcataatatacgacataagtctctaattcggtacgtacacat 5‘
monophosphate nucleotides
A monophospate nucleotide is an ester between a phosphate group and a pentose
in which the carbone 1’ binds a nitrogen base.
(los nucleótidos monofosfatados)
Los nucleótidos monofosfatados son ésteres de fosfato de pentosas en las cuales
una base nitrogenada está unida al carbono 1´ de un pentosa (azúcar).
En los ribonucleótidos (ARN) la pentosa es la D-ribosa,
en los desoxiribonucleótidos (DNA, desoxinucleótidos), el azúcar es 2’-desoxi-D-ribosa
los números primos señalan posiciones de átomos de carbono del azúcar,
los no primos corresponden a la base nitrogenada.
nitrogenous bases
There are 4 nitrogenous bases in DNA:
Adenine, Guanine, Cytosine, and Thymine (A, G, C and T)
Las bases nitrogenadas son moléculas planas, aromáticas y heterocíclicas,
derivadas de la purina (A y G) o de la pirimidina (C y T).
diester bounds
Monophsphate nucleotide of a given strand are attached to each other by diester bounds.
(los enlaces diésteres)
Los nucleótidos monofosfatados de cada cadena son unidos entre sí por enlaces diésteres.
An ester bound:
A-COOH + BOH -----> A-COO-B + H2O
Hydrogen bounds
The two chains of dsDNA molecule are linked together through hydrogen bridges (bounds)
between two facing nitrogenous bases (base pairs). Adenine always pairs with thymine (A-T two
bridges) and cytosine with guanine (G-C, three bridges).
Los puentes de hidrógeno.
Las dos cadenas de nucleótidos que constituyen una molécula de ADN,
se unidas entre sí porque forman enlaces entre las bases nitrogenadas
de ambas cadenas que quedan enfrentadas (g-c, tres puentes y a-t dos puentes).
Intercalating agents
Interrcalating agents are compounds able to place themselves in between successive
bases. Ethidium bromide and SYBR green are such compounds.
SYBR green is used in qPCR.
Intercalating agents are mutagenetic in Procaryotes. SYBR green is not better than
Ethidium Bromide contrarily to what is sometimes advertized.
Both require protections like the use of gloves.
-----------------------Question
Cite two intercalating agents
Fusion and denaturation
(la fusión y desnaturalización del ADN)
Cuando una solución de DNA que ha sido calentada se enfría lentamente
se produce la rehibridación d’ADN lugar a la estructura inicial.
------------------------------Question
1.
what does a mismatch do on the fusion curve
2. is it possible to use the fusion curve to detect a mutation
Probe labelling
Among the various methods of labelling a probe we will describe
The following ones:
1. Random priming
2. Nick translation
3. Polynucleotid kinase
Random priming
Examples of 2 random primers (hexamers):
5‘ ctggtt 3‘
5‘ gccagt 3‘
.........
Let‘s decide that among the nucleotides, t is labelled.
If DNA pol is used to extend these primers, all the t would be labelled.
5‘ctggtt 3‘
3‘ atagaccaactaggacggtcataatatacgacttaagtctctaattcggtacgtacacat 5‘
5‘ctggttgatcctgccagtattatatgctgaattcagagattaagccatgcatgtgta 3‘
3‘ atagaccaactaggacggtcataatatacgacttaagtctctaattcggtacgtacacat 5‘
5‘gccagt 3‘
3‘ atagaccaactaggacggtcataatatacgacttaagtctctaattcggtacgtacacat 5‘
5‘gccagtattatatgctgaattcagagattaagccatgcatgtgta 3‘
3‘ atagaccaactaggacggtcataatatacgacttaagtctctaattcggtacgtacacat 5‘
Nick translation
Using DNAase, we made a few nicks (here one, between the red c and t))
5‘ tatctggttgatcctgccagtattatatgctgaattcagagattaagccatgcatgtgta 3‘
3‘ atagaccaactaggacggtcataatatacgacttaagtctctaattcggtacgtacacat 5‘
The 5‘ --> 3‘ exonucleasic activity of DNA pol I makes a gap fom this nick
5‘ tatctggttgatc----------tatatgctgaattcagagattaagccatgcatgtgta 3‘
3‘ atagaccaactaggacggtcataatatacgacttaagtctctaattcggtacgtacacat 5‘
The DNA pol activity of DNA pol I uses the upstream sequence as a primer
5‘ tatctggttgatcctgccagtattatatgctgaattcag---------tgcatgtgta 3‘
3‘ atagaccaactaggacggtcataatatacgacttaagtctctaattcggtacgtacacat 5‘
Polynucleotide kinase
1.
An alcaline phosphatase cleave off the 5’ phosphates
5‘P tatctggttgaattcagagattaagccatgcatgtgta 3‘
3‘ atagaccaacttaagtctctaattcggtacgtacacat P 5‘
+ alcaline phosphatase (calf or shrimp)
5‘
3‘
1.
tatctggttgaattcagagattaagccatgcatgtgta 3‘
atagaccaacttaagtctctaattcggtacgtacacat 5‘
Polynucleotide kinase replaces these phosphates by the labeleed phosphate of
a radioactive phosphate from a radioactive ATP (a gamma phosphate!)
5‘P tatctggttgaattcagagattaagccatgcatgtgta 3‘
3‘ atagaccaacttaagtctctaattcggtacgtacacat P 5‘
-----------------------question
what‘s a gamma phosphate in ATP
hybridization
DNA/DNA
5‘ tatctggttgatcctgccagtattatatgctgaattcagagattaagccatgcatgtgta 3‘
3‘ atagaccaactaggacggtcataatatacgacttaagtctctaattcggtacgtacacat 5‘
DNA/RNA (the best hybrids)
5‘ uaucugguugauccugccaguauuauaugcugaauucagagauuaagccaugcaugugua 3‘
3‘ atagaccaactaggacggtcataatatacgacttaagtctctaattcggtacgtacacat 5‘
-------------------------Question:
What are the best hybrids DNA/DNA or DNA/RNA ?
Hybridization with a labelled probe
DNA/DNA
the probe will recognize complementary DNA
5‘ tatctggttgatcctgccagtattatatgctgaattcagagattaagccatgcatgtgta 3‘
+
3‘ atagaccaactaggacggtcataatatacgacttaagtctctaattcggtacgtacacat 5‘
------->
5‘ tatctggttgatcctgccagtattatatgctgaattcagagattaagccatgcatgtgta 3‘
3‘ atagaccaactaggacggtcataatatacgacttaagtctctaattcggtacgtacacat 5‘
DNA/RNA
the probe will recognize complementary DNA
5‘ uaucugguugauccugccaguauuauaugcugaauucagagauuaagccaugcaugugua 3‘
+
3‘ atagaccaactaggacggtcataatatacgacttaagtctctaattcggtacgtacacat 5‘
-------->
5‘ uaucugguugauccugccaguauuauaugcugaauucagagauuaagccaugcaugugua 3‘
3‘ atagaccaactaggacggtcataatatacgacttaagtctctaattcggtacgtacacat 5
DNA purification:
A good extraction: DNA breaks quickly !
The human genome contains 5.000.000.000 nucleotides
in 46 molecules (46 chromosomes).
Each chromosome is a complete molecule with a centromere and two telomeres.
Thus a good extraction of human DNA should give 46 molecules.
A good extraction is a dream, DNA is fragile and breaks quickly.
Native human DNA is made of 46 long molecules, this makes its solution viscous.
When you prepare DNA, avoid to shake it, to pipet it…
Any viscosity decrease is a consequence of the breaking of the molecules.
At the ends of each chromosome, there are telomeres. Telomeres allow the
maintaining of DNA in linear molecules.
Telomeres are made by an enzymes called telomerase.
There are several methods to prepare DNA.
Some gives short fragments (2000 - 12.000 bp).
Other gives long fragments (< 1 milion bp)
If you decide to get short fragments, you can use a technic which is called
Shotgun.
phenol-CHCl3
method and kits
Short strands
Phénol-Chloroform method:
yield 5 µg of DNA from 1 milion cells
1. Detach: If the cells are attached to the bottom of the culture flask (dish), remove the
culture medium detach them. When attached, cells bind to each other and to the bottom of
the flask by proteins. These proteins attached only if they have enough calcium. An easy
way to detach cells is the use EDTA.
2. Clean 20 million cells with 50 ml of PBS (4°C), pellet by centrifagation at ± 1500 rpm
(10 minutes).
3. Destroy the proteins: Suspend in 3.8 ml of buffered proteinase K:10 mM tris pH 8, 10
mM EDTA pH 8 and 100 µ/ml proteinase K add then: 200 µl of 20 % SDS. Incubate 2
hours at 37°put into 2059 Falcon tube (15 ml). These tubes resist to phenol!
4. Dissolve nucleic acis in water: add 4 ml of phenol (Mix). Pipet carefully (avoiding
breacking DNA) the aqueous supernatant (viscous because it contains unbroken strands
of DNA)
5. extract this supernatant with 4 ml of HCCl3 - isoamylic alcohol (24/1). Centrifuge
and recuperate 2ml of the aqueous supernatant (which contains the DNA).
6. Purify with ethanol: Add 8 ml of ethanol. Centrifuge (10.000 rpm, 15 minutes) and
eliminate the supernatant... and directly dissolve slowly (18 hr at 4°C) in 2 ml of TE (TE=
10 mM Tris pH 8, 1mM and 1 mM EDTA. RNA can now be removed by RNAse (DNAse
free, 100µg/ml)
DNA purification: phenol-CHCl3 method:
1. Detach: An easy way to detach cells is the use EDTA.
DNA purification: phenol-CHCl3 method
DNA purification: phenol-CHCl3 method
Quality checking: agarose electrophoresis
Ethidium bromide:
5µl para 100 ml de gel tampon.
TAE 50 X
Tris: 24,2 g.
add 5,71 ml d’acido acético glaciale
100 ml d’EDTA 0,5 M pH 8.0
Porter à 1 litre
Interrcalating agents are compounds able to place themselves in between successive bases.
Ethidim bromide and Syber green are such compounds. Sybergreen is used in qPCR
DNA purification: phenol-CHCl3 method: checking purity by electrophoresis
Blue orange 6x: para 24 µl: 4 µl
DNA purification: commercial
kits
Commercial Kits:
Most of them bind DNA to a resin, wash it and detach it.
They have a size and an amount limit which is indicated.
DNA purification: long strands
http://wheat.pw.usda.gov/~lazo/methods/bac/Mega.html
To construct large insert DNA libraries in BAC and YAC vectors, methods were
developed to isolate very high molecular weight DNA,megabase-sizeDNA.
To isolate such DNA:
• 1) intact cells are mixed with molten LMT agarose and set in a mold forming
agarose‘plugs’
• 2) enzymes and detergents diffuse into the plugs and lyse cells
(proteinase K diffuses into plugs and digestsproteins)
• 3) if necessary restriction digests are performedin plugs
(extensive washing or PMSF treatmentis required to remove proteinase K activity)
• 4) plugs are loaded directly onto PFGE and run
SHORT COMMUNICATION
Generation of a Zebrafish P1 Artificial Chromosome
Library
Chris T. Amemiya*,1 and Leonard I. Zon†
Genomics 58, 211–213 (1999)
This library was constructed from pooled erythrocytesof ± 200 adult animals closely
following the methods outlined in Amemiya et al. (12). Briefly, agarose embedded
genomic DNA was partially digested withMboI and electrophoresed in a
preparative pulsed-field gel (CHEF DRIII, Bio-Rad); excised fractions were then
electroeluted into dialysis bags and ligated with BamHI-digested and
dephosphorylated pCYPAC6 (GenBank Accession No. AF133437).
Ligations of various-sized genomic fractions were transformed into
Escherichia coli DH10B (Gibco/BRL) using an E. coliporator (Gibco/BRL) set
to “medium” (16.6 kV/cm fieldstrength), and those size fractions and
ligations consistently yielding inserts of 100–200 kb based on NotI
digests and pulsed-field gel electrophoresis of randomly….
DNA concentration and purity
Measuring the intensity of absorbance of the DNA solution at wavelengths 260 nm and 280nm
is used as a measure of DNA purity. DNA absorbs UV light at 260 nm, and protein absorbs
UV light at 280 nm; a pure sample of DNA should be relatively free of protein and the 260/280
ratio should be high.
A DNA preparation that is contaminated with protein will have a lesser 260/280 ratio.
Euchromatine and heterochromatine
blast
The Basic Local Alignment Search Tool (BLAST) finds regions of local similarity between sequences.
The program compares nucleotide or protein sequences to sequence databases and calculates
the statistical significance of matches.
BLAST can be used to infer functional and evolutionary relationships between sequences
as well as help identify members of gene families.
Query: 1
Sbjct: 1
Query: 61
Sbjct: 61
Query: 121
Sbjct: 121
Query: 181
Sbjct: 181
Query: 241
Sbjct: 240
tatctggttgatcctgccagtattatatgctgatgttagagattaagccatgcatgtgta 60
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||
tatctggttgatcctgccagtattatatgctgatgttaaagattaagccatgcatgtgta 60
agtataaagaccaagtaggatgaaactgcggacggctcattataacagtaatagtttctt 120
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
agtataaagaccaagtaggatgaaactgcggacggctcattataacagtaatagtttctt 120
tggttagtaaagtacaaggatagctttgtgaatgataaagataatacttgagacgatcca 180
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||
tggttagtaaaatacaaggatagctttgtgaatgataaagataatacttgagacgatcca 180
atttgtattagtacaaagtggccaatttatgtaagtaaattgagaaatgacattctaagt 240
|||||||||||||||| ||||||||| || || | |||||||||||||||||||||||
gtttgtattagtacaaaatggccaattcattcaa-tgaattgagaaatgacattctaagt 239
gagttaggatgccacgacaattgtagaacacacagtgtttaacaagtaaccaatgagaat 300
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
gagttaggatgccacgacaattgtagaacacacagtgtttaacaagtaaccaatgagaat 299
Query: 961
Sbjct: 960
gttaggggatcgaagacgatcagataccgtcgtagtcctaactataaacgatgtcaacca 1020
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
gttaggggatcgaagacgatcagataccgtcgtagtcctaactataaacgatgtcaacca 1019
Query: 1021 aggattggatgaaattcagatgtacaaagatgaagaaacattgtttctaaatccaagtat 1080
||||||||||||||||||||||||||||||| |||| ||||||||||| ||| |||||
Sbjct: 1020 aggattggatgaaattcagatgtacaaagatagagaagcattgtttctagatctgagtat 1079
Query: 1081 atcaatactaccttgttcagaacttaaagagaaatcttgagtttatggacttcaggggga 1140
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1080 atcaatattaccttgttcagaacttaaagagaaatcttgagtttatggacttcaggggga 1139
DNA strider, another soft
E.dispar gene for small subunit ribosomal RNA (SSUrRNA).
ACCESSION Z49256
E.dispar (SSU rRNA), unique restriction sites
E.histolytica gene for small subunit ribosomal RNA (SSU rRNA).
ACCESSION X56991
E.histolytica (SSU rRNA), unique restriction sites
Query: 961
Sbjct: 960
gttaggggatcgaagacgatcagataccgtcgtagtcctaactataaacgatgtcaacca 1020
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
gttaggggatcgaagacgatcagataccgtcgtagtcctaactataaacgatgtcaacca 1019
Query: 1021 aggattggatgaaattcagatgtacaaagatgaagaaacattgtttctaaatccaagtat 1080
||||||||||||||||||||||||||||||| |||| ||||||||||| ||| |||||
Sbjct: 1020 aggattggatgaaattcagatgtacaaagatagagaagcattgtttctagatctgagtat 1079
Query: 1081 atcaatactaccttgttcagaacttaaagagaaatcttgagtttatggacttcaggggga 1140
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1080 atcaatattaccttgttcagaacttaaagagaaatcttgagtttatggacttcaggggga 1139
Descargar

DNA-dblehelix - Site GENEMOL 2013