Genética de Poblaciones I:
La revolución Darwiniana
Dr. Antonio Barbadilla
Tema 17: Genética Poblaciones I
1
Tema 17: Genética de Poblaciones I: La revolución
darwiniana, el equilibrio de Hardy-Weinberg y sistemas
de apareamiento
Puntos principales a tratar:
•La revolución darwiniana: el pensamiento
poblacional
•La selección natural
•Principios de la selección natural
•La variación genética y sus estimación
•Población mendeliana
•Apareamiento aleatorio y ley de Hardy-Weinberg
•Apareamiento no aleatorio
•Apareamiento clasificado
•Endogamia
Tema 17: Genética Poblaciones I
2
Dr. Antonio Barbadilla
Nada tiene sentido en biología
Nothing in Biology makes
si
no
es
a
la
luz
de
la
sense except in the light of
evolución
evolution
Theodosius
Theodosius Dobzhansky
Dobzhansky
Dr. Antonio Barbadilla
Tema 17: Genética Poblaciones I
3
EL PARADIGMA
POBLACIONAL:
la variación en
el seno de las
poblaciones es
la materia
prima de la
evolución
Dr. Antonio Barbadilla
Tema 17: Genética Poblaciones I
5
Lo único que se trasmite a la descendencia son
genes
Genotipo
Siguiente
generación
Fenotipo
Expresión génica, desarrollo
Transmisión
Dr. Antonio Barbadilla
Tema 17: Genética Poblaciones I
6
Evolución desde la perspectiva
poblacional:
Es el cambio acumulativo en la
composición genética de las
poblaciones
Dr. Antonio Barbadilla
Tema 17: Genética Poblaciones I
7
Población mendeliana:
Conjunto de individuos intercruzables que
comparten un acervo genético común
Dr. Antonio Barbadilla
Tema 17: Genética Poblaciones I
8
La problemática de la
genética de poblaciones es
la descripción y explicación
de la variación genética
dentro y entre poblaciones
Theodosious Dobzhansky
Dr. Antonio Barbadilla
Tema 17: Genética Poblaciones I
9
•Variación genética o polimorfismo genético:
existencia en una población de dos o más formas
alélicas en frecuencias apreciables
•Frecuencia génica o alélica (unidad básica de
evolución):
f(A) proporción de un alelo dado en la población
Gen X, alelos A y a
p = f(A)
A
a
q = f(a)
Dr. Antonio Barbadilla
Tema 17: Genética Poblaciones I
10
La Genética de Poblaciones es
una Teoría de Fuerzas
Factores que cambian las frecuencias génicas en las
poblaciones
Deriva genética
Migración
p = f(A)
Mutación
Dr. Antonio Barbadilla
Selección natural
Tema 17: Genética Poblaciones I
11
El problema empírico: la lucha por la
medida de la variación genética
Variación fenotípica cuantitativa: morfológica,
fisiológica, conductual
Genética Cuantitativa
Continua y discreta ->
Experimentos de selección, endogamia
X
Dr. Antonio Barbadilla
X
Conclusión:
Existe variación genética para casi
cualquier
carácter
Tema 17: Genética Poblaciones I
12
El problema empírico: la lucha por la
medida de la variación genética (2)
Variación cualitativa: polimorfismos
genéticos y variantes raras
•Polimorfismo morfológico (color,
tamaño, forma)
•Polimorfismo inmunológico (grupos
sanguíneos: AB0, Rh, NM,... 40 en
humanos)
•Polimorfismo cromosómico (inversiones
paracéntricas en Drosophila,
reordenaciones)
Dr. Antonio Barbadilla
Tema 17: Genética Poblaciones I
13
Caracol de huerta europeo Cepaea nemoralis
Dr. Antonio Barbadilla
Tema 17: Genética Poblaciones I
14
Geómetra del abedul Biston betularia
Dr. Antonio Barbadilla
Tema 17: Genética Poblaciones I
15
Cromosomas politénicos de Drosophila
Dr. Antonio Barbadilla
Tema 17: Genética Poblaciones I
16
Teorías de la variación en los 60
Teoría clásica
Teoría equilibradora
•Ausencia de variación
•Variación ubicua
•Selección purificadora
•Selección equilibradora
•Genotipo salvaje es
óptimo
•No existe un genotipo
salvaje
•Muller (laboratorio)
•Dobzhansky (naturalista)
•Eugenesia
Dr. Antonio Barbadilla
•¡Viva la diversidad!, no
interferencia
Tema 17: Genética Poblaciones I
17
El problema empírico: la lucha por la
medida de la variación genética (y 3)
Dr. Antonio Barbadilla
•Polimorfismo proteico
(alozímico) Electroforesis de
proteínas en gel (Lewontin &
Hubby 1966; Harris 1966)
-> era alozímica: la variación
es ubicua. Consecuencia
teórica: teoría neutralista.
Nace la evolución molecular.
•Polimorfismos en el nivel del
DNA
•RFLPs
•Microsatélites
Tema 17: Genética Poblaciones I
•Secuencias de DNA
18
Polimorfismos de DNA
Dr. Antonio Barbadilla
Tema 17: Genética Poblaciones I
19
Polimorfismos de DNA
SNPs
Single Nucleotide Polymorphism
AGAGTTCTGCTC G
AG G GTTATG C G C G
Secuencia 11
Secuencia 22
Secuencia 33
Secuencia
Secuencia
Secuencia
Secuencia
Secuencia
Secuencia
Dr. Antonio Barbadilla
4
5
6
7 7
88
9
acgtagcatcgtatgcgttagacgggggggtagcaccagtacag
acgtagcatcgtatgcgttagacggggtggtagcaccagtacag
acgtagcatcgtatgcgttagacggcggggtagcaccagtacag
acgtagcatcgtttgcgttagacgggggggtagcaccagtacag
acgtagcatcgtttgcgttagacgggggggtagcaccagtacag
acgtagcatcgtttgcgttagacggcatggcaccggcagtacag
acgtagcatcgtttgcgttagacggcatggcaccggcagtacag
acgtagcatcgtttgcgttagacggcatggcaccggcagtacag
acgtagcatcgtttgcgttagacggcatggcaccggcagtacag
Tema 17: Genética Poblaciones I
20
Medidas de la diversidad genética
Ejemplo: Estudio electroforético de la enzima glucosa
fosfato isomerasa en una población de ratones
Genotipo
F/F
F/S
S/S
Total
N. individuos
4
7
5
16
N. alelos F
8
7
0
15
N. alelos S
N. alelos F + S
0
8
7
14
10
10
17
32
•Frecuencia genotípica
f(FF) = 4 / 16
f(FS) = 7 /16
•Frecuencia alélica o génica
4 + (1/2) 7
^ = f(F) =
p
= 0,469
•Heterocigosidad
Dr. Antonio Barbadilla
f(SS) = 5/16
^=1- p
^ = 0,531
q
16
^ Tema 17: Genética Poblaciones I
H = 7/16
= 0,4375
21
Frecuencias genotípicas y alélicas para el locus del
grupo sanguíneo MN en varias poblaciones humanas
G e n o tipo
F re c u e n c ia s
a lé lic a s
P o b la c ió n
MM
MN
NN
p (M )
p (N )
E sq u im al
0 ,8 3 5
0 ,15 6
0 ,0 0 9
0 ,9 13
0 ,0 8 7
A b o rig e n
0 ,0 2 4
0 ,3 0 4
0 ,6 7 2
0 ,17 6
0 ,8 2 4
E g ip c ia
0 ,2 7 8
0 ,4 8 9
0 ,2 3 3
0 ,5 2 3
0 ,4 7 7
A le m an ia
0 ,2 9 7
0 ,5 0 7
0 ,19 6
0 ,5 5 0
0 ,4 5 0
C h in a
0 ,3 3 2
0 ,4 8 6
0 ,18 2
0 ,5 7 5
0 ,4 2 5
N ig e ria
0 ,3 0 1
0 ,4 9 5
0 ,2 0 4
0 ,5 4 8
0 ,4 5 2
A u stralia
Dr. Antonio Barbadilla
Tema 17: Genética Poblaciones I
22
Frecuencia de los alelos IA, IB, e i en el locus del grupo
sanguíneo ABO en varias poblaciones humanas
P o b la c ió n
I
A
I
B
i
E sq u im a l
0 ,3 3 3
0 ,0 2 6
0 ,6 4 1
S io u x
0 ,0 3 5
0 ,0 10
0 ,9 5 5
B e lg a
0 ,2 5 7
0 ,0 5 8
0 ,6 8 4
J aponés
0 ,2 7 9
0 ,17 2
0 ,5 4 9
P ig m e a
0 ,2 2 7
0 ,2 19
0 ,5 5 4
Dr. Antonio Barbadilla
Tema 17: Genética Poblaciones I
23
Patrones de variación
electroforética
Dr. Antonio Barbadilla
Tema 17: Genética Poblaciones I
24
Ley del equilibrio de Hardy-Weinberg
Considera como se relacionan las frecuencias alélicas y
genotípicas en una población mendeliana bajo una serie de
supuestos ideales
•Generaciones discretas y no solapantes
•Apareamiento aleatorio
•Tamaño de población infinito
•No mutación, no migración entre poblaciones
•No diferencias en eficacia biológica (selectivas) entre
los distintos genotipos
Dr. Antonio Barbadilla
Tema 17: Genética Poblaciones I
25
Los supuestos implican una unión aleatoria
de los alelos para formar genotipos
Esperma
p
A
Frecuencias
alélicas
A
p
a
q
AA
p2
Aa
pq
Aa
pq
aa
q2
q
a
Huevos
Dr. Antonio Barbadilla
Tema 17: Genética Poblaciones I
26
Ley del equilibrio de Hardy-Weinberg
Consecuencias de los supuestos:
•Reducción de la dimensionalidad de una población. Conociendo las
frecuencias alélicas podemos predecir las genotípicas
•Equilibrio alélico y genotípico.
•Las frecuencias alélicas no cambian de generación en
generación (equilibrio alélico)
•Las frecuencias genotípicas no cambian de generación en
generación (equilibrio genotípico). Después de una generación
de apareamiento aleatorio, se alcanzan las frecuencias
genotípicas de equilibrio
•Sistema conservativo, análogo al principio de inercia. Solución al
problema de cómo se conserva la variación genética
•Modelo nulo por excelencia: Aunque las desviaciones son difíciles
de detectar, cualquier desviación es una indicación de que algo pasa
en la población
Dr. Antonio Barbadilla
Tema 17: Genética Poblaciones I
27
Demostración de la ley de Hardy-Weinberg F r e c u e n c ia c ig o t o s (p r o g e n ie )
P = f(AA)
Q = f(Aa)
R = f(aa)
A p a r e a m ie n t o
F r e c u e n c ia
AA
Aa
aa
1
0
0
a p a r e a m ie n t o
2
AA x AA
P
AA x Aa
2PQ
½
½
0
A A x aa
2PR
0
1
0
¼
½
¼
0
½
½
0
0
1
2
Aa x Aa
Q
A a x aa
2Q R
aa x aa
R
2
Totales próxima generación
P’
P’ = P2 + 2PQ/2 + Q2/4 = (P + Q/2)2 = p2
Dr. Antonio Barbadilla
igualmente se demuestra que Q’ = 2pq y R’ = q2
Tema 17: Genética Poblaciones I
Q’
R’
28
0 0,1 0,2 0,3 0,4 0,5 0,6 0,7 0,8 0,9 1,0
Frecuencia
Gráfico de p2, 2pq y q2.
q2 (aa)
p2 (AA)
2pq (Aa)
0 0,1 0,2 0,3 0,4 0,5 0,6 0,7 0,8 0,9 1,0
p = f(A)
Dr. Antonio Barbadilla
Tema 17: Genética Poblaciones I
29
Prueba de ajuste a Hardy-Weinberg
G e n o tip o
MM
MN
NN
T o ta l
N . in d iv id u o s
17 8 7
3037
13 0 5
6 12 9
N . a le lo s M
3574
3037
0
6 6 11
N . a le lo s N
0
3037
2 6 10
5647
3574
6074
2 6 10
12 2 5 8
N . a le lo s M + N
Frecuencia alélica M = 6611/12258 = 0,53932 = p
Frecuencia alélica N = 5647/12258 = 0,46068 = q
Frecuencia esperada
Número esperada
(Frecuencia X 6129)
X 
2
p2 = 0,2908 2pq = 0,4969 q2 = 0,2122
1782,7
(número
3045,6
1300,7
observado  número
esperado )
número
Dr. Antonio Barbadilla
1,000
6129
2
 0,04887
esperado
 02, 05;1g .l .  3,84
Tema 17: Genética Poblaciones I
30
Generalización del Equilibrio de Hardy-Weinberg
•Dominancia
Se puede estimar las frecuencias alélicas si suponemos que
la población está en equilibrio Hardy-Weinberg. Ej. Individuos con
fenotipo Rh+ 85%. Si suponemos H-W la frecuencia del alelo Rh+ es
del 85.8%
•Múltiples alelos
Ejemplo, 3 alelos con frecuencias p,q y r. Las frecuencias
genotípicas son las que resultan de las expansión (p+q+r)2 = p2 +
2pq + 2pr + q2 + 2qr + r2
•Un gen ligado al X
A1 A1
A1 A2
A2A2
A1
A2
P2
2pq
q2
p
q
Dr. Antonio Barbadilla
Tema 17: Genética Poblaciones I
31
Desviaciones del apareamiento aleatorio
•Apareamiento clasificado: los distintos fenotipos
no se aparean al azar
•positivo: tendencia a aparearse con fenotipos
semejantes (altura, color de piel,...)
•negativo: tendencia a aparearse con fenotipos
opuestos
•Endogamia: cuando el cruce entre parientes es
más común de lo que se espera por azar (exogamia
es el concepto opuesto)
Diferencias entre ambos conceptos: el apareamiento clasificado afecta
a los
fenotipos preferidos, mientras que la endogamia afecta a todo el
Dr. Antonio
Barbadilla
Tema 17: Genética Poblaciones I
32
genoma
Consecuencias de las desviaciones del
apareamiento aleatorio
•Desviación de las frecuencias genotípicas de las
esperadas por Hardy-Weinberg
•Mayor homozigosidad: apareamiento
clasificado positivo y endogamia
•Mayor heterozigosidad: apareamiento
clasificado negativo
•No cambio en las frecuencias alélicas
Dr. Antonio Barbadilla
Tema 17: Genética Poblaciones I
33
Problemas de exámenes pasados
•En una població que està en equilibri de Hardy-Weinberg, la freqüència de l’al.lel A és de 0,7 i la de l’al.lel a és de 0,3. a)
Quin percentatge de la població serà homozigòtica? b) Quines seran les freqüències gèniques i genotípiques després d’una
generació, si solament s’encreuen els heterozigots?
•Si el 4% dels individus d’una població que es troba en equilibri Hardy-Weinberg manifesta un fenotip recessiu, quina és la
probabilitat de que un descendent de dos individus que no expressin aquest caràcter recessiu, si que l’expressi?
•En una població animal, el 20% dels individus són AA, el 60% són Aa i el 20% són aa. Quines són les freqüències al.lèliques?
•En aquesta població els encreuaments sempre són entre fenotips semblants, però dins de cada grup fenotípic és a l’atzar.
Quines freqüències genotípiques i al.leliques hi haurà a la següent generació?
•En una població humana constituida per 100.000 individus, el 40% són del grup sanguini A, el 28% del B, el 25% de l'AB i la
resta del 0. a) Calculeu les freqüències gèniques i genotípiques. b) En quin supòsits us heu basat per respondre l'apartat
anterior?
•Comenteu l’efecte que té la deriva genètica en les poblacions naturals. De què depèn la força de la deriva genètica?
Expliqueu dos casos típics de deriva genètica, il•lustrant-los amb exemples reals.
•El daltonisme és causat per un al.lel recessiu lligat al sexe. Un de cada deu homes és daltònic. Si suposem que la població
està en equilibri de Hardy-Weinberg, a) Quina és la proporció de dones daltòniques? b)
Quants homes daltònics hi ha per
cada dona daltònica? c) En quina proporció de les parelles afectarà el daltonisme a la meitat dels fills de cada sexe? d) Quina
és la proporció de parelles en les que tots els fills són normals?
Dr. Antonio Barbadilla
Tema 17: Genética Poblaciones I
34
Links de interés
 Web de genética de poblaciones (A. Barbadilla)
 Ensayos de evolución (A. Barbadilla)
 EvoTutor: Learning through interactive simulation
(on line y off line) Sitio excelente para aprender los
procesos genético poblacionales mediante simulación
 Calculadora de Hardy-Weinberg
Dr. Antonio Barbadilla
Tema 17: Genética Poblaciones I
35
Descargar

Tema 17: Genética Poblaciones I