Endonucleasas de Restricción
Enzimas que tienen la capacidad de cortar DNA doble cadena en una
secuencia específica o restringida
Extraídas y clonadas de bacterias:
Nombre de ER: según la bacteria a partir de la cual fue aislada
Ejemplo: EcoRI
Eco: Género y especie: Escherichia coli
R: Cepa RY12
I: primer ER aislada de este organismo
Forman parte de un sistema de Restricción-Modificación, actuando
como un sistema de defensa contra patógeno, protegiéndolas del
ataque de DNA foráneo (ej.: bacteriófago).
R: endonucleasa (corta DNA doble cadena rompiendo uniones
fosfodiéster)
M: modifica al DNA por metilación (metilasa)
Es decir, cada enzima de restricción tiene una metilasa asociada.
• Ambas enzimas reconocen la misma secuencia de bases. La metilasa
metila una base determinada siempre dentro de la secuencia de
reconocimiento, mientras que la endonucleasa puede cortar dentro
de la secuencia de reconocimiento o fuera de ella, dependiendo del
tipo de enzima.
•La metilación en las dos hebras del DNA evita que la Enzima de
Restricción pueda cortar la molécula de DNA. Este mecanismo es
empleado por las bacterias para proteger a su propio DNA genómico
y plasmídico del ataque de sus propias Enzimas.
1
Ejemplo: (específico para las de Tipo II)
1) Ambas cadenas metiladas
CH3
5´---- GAATTC ---- 3´
3´---- CTTAAG ---- 5´
CH3
2) Sólo una cadena metilada
5´---- GAATTC ---- 3´
3´---- CTTAAG ---- 5´
CH3
3) Ninguna cadena metilada
5´---- GAATTC ---- 3´
3´---- CTTAAG ---- 5´
no hay ni metilación ni restricción
M.EcoRI
R.EcoRI
CH3
5´---- GAATTC ---- 3´
3´---- CTTAAG ---- 5´
CH3
hay metilación y no restricción
M.EcoRI
R.EcoRI
CH3
5´---- GAATTC ---- 3´
3´---- CTTAAG ---- 5´
CH3
no hay metilación, sí restricción
M.EcoRI
R.EcoRI
5´---- G
AATTC ---- 3´
3´---- CTTAA
G ---- 5´
El sistema R-M funciona como un sistema “inmune”
• Mecanismo para resistir el ataque viral
• Permite a la bacteria distinguir entre DNA propio y DNA foráneo:
 las ER digieren al DNA foráneo no metilado
 y protegen DNA propio por metilación
2
¿Por qué el sistema R-M funciona como un “sistema inmune”?
CH3
Caso 1
5´---- GAATTC --------------- AAGCTT---- 3´
3´---- CTTAAG ----------------TTCGAA---- 5´
CH3
EcoRI
HindIII
DNA del fago con las
secuencias de
reconocimiento de
ambas ER
Lisis
Bacteria EcoRI+ HindIII-
Caso 2
No hay lisis
Bacteria EcoRI- HindIII+
CH3
Caso 3
5´---- GAATTC --------------- AAGCTT---- 3´
3´---- CTTAAG ----------------TTCGAA---- 5´
CH3
EcoRI
HindIII
DNA del fago con las
secuencias de
reconocimiento de
ambas ER
No hay lisis
3
Bacteria EcoRI+ HindIII-
DNA metilasas o metiltransferasas:
•Transferencia de un grupo metilo desde una molécula donante
(SAM) a una A y C:
•No requieren Mg2+ como cofactor
Eucariotas: asociadas a la inactivación génica: metilaciones en la
posición C5 de las C en islas CpG
Procariotas: participan principalmente del sistema R-M
En las cepas de E.coli de laboratorio existen 3 DNA-MT:
Sistema hsd: AAC(N6)GTGC and GCAC(N6)GTT
Dam metilasa: GATC
Dcm metilasa: CCAGG y CCTGG
DNA plasmídico aislado de cepas E.coli Dam+ son resistentes al
corte por MboI (GATC)
Si se quiere clivar una molécula recombinanate con ER sensibles a
la metilación por estas MT, la misma debe ser amplificada y aislada
a partir de cepas Dam- y Dcm-
4
Sistema de Restricción metilasa dependiente
Endonucleasas que clivan DNA doble cadena cuando está doblemente
metilado o hemimetilado
En E.coli existen tres sistemas:
 MrcA:
m5CG
 MrcBC:
Pum5CG
 Mrr:
m6A
Clasificación de ER
Composición de las subunidades
Especificidad de la secuencia de reconocimiento
Sitio de clivaje
Requerimiento de cofactores
5
Clasificación de ER
ER
Tipo I
Tipo II
Tipo IIs
Tipo III
Estructura
proteica
Bifuncional, 3
subunidades
Unifuncional,
endonucleasa y
metilasa en
enzimas
separadas
Unifuncional,
endonucleasa y
metilasa en
enzimas
separadas
Bifuncional, 2
subunidades
distintas
Sitio de
reconocimiento
Asimétrico y
bipartito
Secuencia
palindrómica
(simétrica),
4-6 pb (tb de
8pb)
Asimétrico y
continuo
Asimétrico,
5-7 pb.
R: secuencia
duplicada en
direcciones
opuestos
Sitio de clivaje
No específico
› 1000pb del
sitio de
reconocimiento
En el mismo sitio
de
reconocimiento
o adyacente a
este
A distancias
fijas del sitio
de
reconocimiento
(fuera del
mismo)
24-26 pb río
abajo del sitio
de
reconocimiento
Requerimientos
ATP para
moverse del
sitio de
reconocimiento
al de clivaje,
Mg2+, SAM
No ATP
Mg2+, (la M
requiere SAM)
Mg2+, (la M
requiere SAM)
No ATP
ATP para
moverse del
sitio de
reconocimiento
al de clivaje,
Mg2+, SAM
Ejemplo
EcoKI
EcoRI
AwlI
EcoP15
AACN6GTGC
TTGN6CACG
Uso en biología
molecular
No generan
fragmentos de
tamaño
definido
CAGCAG(N)CTGCTG
GTCGTC(N)GACGAC
Generan
fragmentos de
tamaño definido,
se usan en el
laboratorio!!!
Generan
fragmentos de
tamaño definido
No generan
fragmentos de
tamaño definido
6
Tipo II (las que se emplean en el laboratorio)
Las secuencias de reconocimiento pueden ser:
sec palindrómicas y continuas (reconocidas por homodímeros)
Ejemplo: EcoRI
Secuencias simétricas y discontinuas (reconocidas por homodímeros)
Ejemplo: BglI
sec asimétricas y continuas (reconocidas por heterodímeros)
Ejemplo: BbvCI
Código de una letra
N = A or C or G or T
7
Extremos:
Romos:
5´----CCCGGG ---- 3´
3´----GGGCCC ---- 5´
SmaI
5´----CCC
3´----GGG
GGG ---- 3´
CCC ---- 5´
Cohesivos:
•5’ protruyente
5´---- GAATTC ---- 3´
3´---- CTTAAG ---- 5´
EcoRI
5´---- G
AATTC ---- 3´
3´---- CTTAA
G ---- 5´
•3’ protruyente
5´---- CTGCAG ---- 3´
3´---- GACGTC ---- 5´
PstI
5´----CTGCA
3´----G
G ---- 3´
ACGTC ---- 5´
• La ligación de extremos cohesivos requiere complementariedad de
secuencia
• La ligación de extremos romos no requiere de secuencias
complementarias: dos extremos romos cualquiera pueden ser unidos por
la DNA ligasa.
• La eficiencia de ligación de extremos cohesivos es mayor que la de
extremos romos.
8
Isoesquizómeros:
Son distintas ER que reconocen la misma secuencia, generalmente con
distintas especificidades. Pueden generar:
los mismos extremos: Acc65I y KpnI
5´----G
GTACC ---- 3´
3´----CCATG
G ---- 5´
5´----GGTACC ---- 3´
3´----CCATGG ---- 5´
distintos extremos:
5´----CCCGGG ---- 3´
3´----GGGCCC ---- 5´
5´----CCCGGG ---- 3´
3´----GGGCCC ---- 5´
SmaI
5´----CCC
3´----GGG
GGG ---- 3´
CCC ---- 5´
XmaI
5´----C
CCGGG ---- 3´
3´----GGGCC
C ---- 5´
ER que reconocen distintas secuencias, pero dejan los mismos
extremos:
5´----GGATCC ---- 3´
3´----CCTAGG ---- 5´
5´----AGATCT ---- 3´
3´----TCTAGA ---- 5´
BamHI
5´----G
GATCC ---- 3´
3´----CCTAG
G ---- 5´
BglII
5´----A
GATCT ---- 3´
3´----TCTAG
A ---- 5´
9
Cómo generar nuevas secuencias de corte
1- Corte, filling in/trimming back, religación:
Filling in (5’ protruyente)
5´---- GAATTC ---- 3´
3´---- CTTAAG ---- 5´
EcoRI
5´---- G
AATTC ---- 3´
3´---- CTTAA
G ---- 5´
fill in
dNTPs)
ligasa
5´---- GAATTAATTC ---- 3´
3´---- CTTAATTAAG ---- 5´
5´---- GAATT
3´---- CTTAA
(con DNApol +
AATTC ---- 3´
TTAAG ---- 5´
XmnI (GAANN/NNTTC)
Trimming back (3’protruyente)
5´---- CTGCAG ---- 3´
3´---- GACGTC ---- 5´
PstI
5´----CTGCA
3´----G
G ---- 3´
ACGTC ---- 5´
3´-5´exonucleasa
5´----C
3´----G
G ---- 3´
C ---- 5´
Ligados entre sí o a otros
fragmentos con extremos romos 10
2- Ligación de extremos complementarios:
BamHI
5´----GGATCT---- 3´
3´----CCTAGA ---- 5´
5´----G
GATCC ---- 3´
3´----CCTAG
G ---- 5´
Ligasa
BglII
5´----A
GATCT ---- 3´
3´----TCTAG
A ---- 5´
5´----AGATCC ---- 3´
3´----TCTAGG ---- 5´
MboI (/GATC)
3- Ligación de extremos romos:
AluI
5´----AG
3´----TC
EcoRV 5´----GAT
3´----CTA
CT---- 3´
GA---- 5´
ATC---- 3´
TAG---- 5´
5´----AGATC---- 3´
3´----TCTAG---- 5´
Ligasa
MboI (/GATC)
5´----GATCT---- 3´
3´----CTAGA---- 5´
11
Usos en el laboratorio
Generar fragmentos de DNA de tamaño definido para:
• generar moléculas recombinantes: clonado
NcoI
NcoI
HindIII
HindIII
Digestión con
ER
Fragmento
amplificado
p
p
+
Yep51
Ligación
•Screening de transformantes por ER
Digestión
con
HindIII
Calle1: markers (23.13, 9.42, 6.55,
4.36, 2.32, 2.07 y 0.56 kpb)
Calle2: vector digerido sin inserto
Calle3: vector con inserto digerido
(digestión completa)
12
En el laboratorio: reacción de digestión con ER
1) Elección de la ER
Extremos, secuencia y frecuencia de corte, y la cepa
2) Reacción de digestión
DNA (≤1 μg) libre de contaminantes
Buffer de reacción (1X)
(viene 10X)
ER (1 μl= 10U)
H2O csp 50μL
pH (Tris-Cl)
sales (NaCl o KCl) =Fi
cofactores (Mg2+)
BSA
mantener en frío
última en ser agregada
glicerol < 5% v/v
1UE: cantidad de enzima que corta
completamente 1 μg de DNA del fago
lambda en un volumen de 50 μl en 1 hs
usando el buffer correspondiente
3) Mezcla: pipetear + spin-down
4) T 37ºC (ó 50-65ºC)
5) tiempo: 1 hs
(compromiso entre tiempo y cantidad de enzima)
Tiempos muy prolongados: cortes inespecíficos: “Actividad STAR”
6) Frenar de la reacción:
• calor o shock térmico (65-80ºC por 20’)
• fenol/cloroformo y posterior precipitación del DNA
13
Actividad STAR:
Algunas enzimas (en condiciones de reacción que no son las óptimas) pueden
producir cortes en secuencias que son similares a sus secuencias de corte.
Ejemplo:
EcoRI en condiciones óptimas cliva:
5´ G/AATTC 3´
en condiciones no óptimas puede clivar:
5´ N/AATTN 3´
Condiciones que contribuyen a la actividad STAR
1- glicerol [>5% v/v]
2- alta UE/ µg of DNA (>100 UE/µg)
3- baja Fi [<25 mM]
4- alto pH [>pH 8.0]
5- sv orgánicos (DMSO, etanol)
6- sustitución de Mg++ por otros cationes divalentes (Mn++, Cu++, Co++, Zn++)
7- tiempo de incubación mayor al óptimo
8- fragmento de DNA amplificado por PCR, sin previa purificación del mismo
Cómo inhibir la actividad STAR
1- mín UE (digestión completa)
2- DNA libre de contaminantes
3- aumentar Fi 100-150 mM
4- pH 7.0.
5- Mg++
14
En los catálogos se describen las distintas características de cada
enzima, como las siguientes:
15
Secuencia a digerir:
Existen programas en internet en los cuales uno puede introducir la
secuencia de bases completa simple cadena y obtener el MAPA DE
RESTRICCIÓN. Ejemplo: Neb cutter V2.0
Secuencia del gen BCY1:
Z
No presenta las secuencias de corte para HindIII ni NcoI
16
Digestión doble
Digerir un mismo fragmento de DNA con dos ER distintas. Por
ejemplo: hacer clonado direccional
evitar tener que precipitar al DNA dos veces, lo cual podría resultar
en la pérdida de masa de DNA
ahorrar tiempo
A tener en cuenta:
• En el vector:
Las secuencias de reconocimiento de las ER a emplear no deberán
solaparse, y deberán estar a una determinada distancia en pb cuando
se realiza una digestión doble.
Nco
I
• En el fragmento: la distancia del sitio de corte al extremo del
fragmento NcoI
Primers:
Forward: 5' GACCATGGTATCTTCTTTGCCCAAGG 3'
Reverse: 5' GGAAGCTTTTAATGTCTTGTAGGAT 3'
HindIII
17
Digestión doble
•
Buffer de reacción compatible
Incompatibilidad
digestión secuencial :
a) corrección del buffer o T
b) precipitación del DNA
Tabla de doble entrada:
18
Descargar

Enzimas de Restriccin 2009