Análisis molecular de la mutación del EGFR en el
CPCNP: perspectiva del patólogo en el laboratorio
de biología molecular
Dra. Edith Illescas
Patóloga y Directora del Laboratorio Oncogen S.R.L.
Buenos Aires, Argentina
¿Cuándo debe analizarse el EGFR en el
CPCNP?
• Selección de pacientes para terapias TKI[a]
• No deben ser excluidos pacientes basándonos en
características clínicas:[b]
–
–
–
–
Etnia
Sexo
Edad
Historia del hábito de fumar
CPNCP = cáncer de pulmón de células no pequeñas
TKI = inhibidor de la tirosina quinasa
a. Rosell R, et al. Lancet Oncol. 2012;13:239-246.
b. Zorrilla AF, et al. J Clin Oncol. 2012;30(Suppl):Abstract e18114.
¿Qué carcinomas deben analizarse?
Recomendaciones del Colegio Americano de Patólogos
y aplicación en Latinoamérica
• Para carcinomas
– Tipo histológico adenocarcinoma y carcinomas mixtos con
componente de adenocarcinoma, sin tener en cuenta el grado
histológico
• No se recomienda en carcinomas de:
– Células escamosas puras
– Células pequeñas puras
– Células grandes sin parámetros por inmunohistoquímica de
evidencia de diferenciación adenocarcinomatosa
College of American Pathologists http://www.cap.org/apps/cap.portal
¿Qué carcinomas deben analizarse? (cont.)
Recomendaciones del Colegio Americano de Patólogos
y aplicación en Latinoamérica
• Se recomienda en los carcinomas realizar la determinación
molecular independientemente del tipo histológico:
– En muestras pequeñas (punción aguja fina – citológicos)
– Cuando el componente adenocarcinomatoso no puede ser
confirmado ni excluido
– En tumores de tipo indiferenciados
– Muestras de metástasis óseas que han sido descalcificadas o
pretratadas con ácidos deben solo utilizarse para el análisis en caso
de ser el único material biológico
College of American Pathologists http://www.cap.org/apps/cap.portal
¿Cuándo debe analizarse el paciente?
• En el momento del diagnóstico, de la recurrencia o de la
progresión
• En pacientes en tratamiento de 1ª y/o 2ª línea
• En tumores primarios – recurrencia y/o metástasis
• En carcinomas en estadio avanzado (IV)
• En estadios I, II y III, se tomará la decisión en colaboración
interdisciplinaria con los médicos que lo están tratando
College of American Pathologists http://www.cap.org/apps/cap.portal
¿En qué tiempo deberá estar disponible el
resultado?
• En 5 a 7 días hábiles - comienzo del tratamiento en
el momento adecuado
• Dentro de las 48 h siguientes de la recepción de la
muestra en el laboratorio, deberá confirmarse bajo
control microscópico la viabilidad del análisis por
metodología molecular
College of American Pathologists http://www.cap.org/apps/cap.portal
¿Qué muestras pueden estudiarse?
TODAS
•
•
•
•
•
•
•
Taco de parafina de resección quirúrgica
Biopsia por punción
Citológico
Impronta
Extendido
Material fresco
Material fijado en alcohol
Hay que tener en cuenta que los requerimientos para
inmunohistoquímicas y FISH (conservación proteica)
no son necesarios para técnicas de ADN
College of American Pathologists http://www.cap.org/apps/cap.portal
¿Qué requerimientos son necesarios?
• Viabilidad de la muestra
• Microscopia óptica
–
–
–
–
Presencia de células tumorales
Calidad de células tumorales
Cantidad de células tumorales (10%)
Proporción de células tumorales
• Selección de sectores tumorales bajo control
microscópico de una tinción hematoxilina-eosina en
la disección del corte en blanco, evitando tejido wildtype, si es posible
College of American Pathologists http://www.cap.org/apps/cap.portal
Envío incorrecto de la muestra
Múltiples cortes de
parafina
Tumor quirúrgico
Hay tumor ???
Imagen cortesía del Laboratorio Oncogen S.R.L.
Múltiples cortes de
parafina
Biopsia por punción
Hay tumor???
Microdisección
Corte en
blanco
Imagen cortesía del Laboratorio Oncogen S.R.L.
¿Qué metodologías de detección deben
utilizarse?
Metodologías que detecten un mínimo del 10% de
células tumorales y el 99,9% de las alteraciones
génicas posibles
• Sistema de PCR de los exones 18, 19, 20 y 21
Sistema nested o heminested (recomendable en material
parafinado)
Recomendación técnicas por PCR nested y
secuenciación automática
College of American Pathologists http://www.cap.org/apps/cap.portal
¿Cómo debe entregarse el resultado?
• Con la alteración génica encontrada, indicar la inserción,
mutación, deleción, el codón y el aminoácido
• Incluir la interpretación adecuada concreta y completa del
tipo de alteración y su implicancia en el tratamiento con TKI
• Alteración clásica o no clásica
• Entrega de los informes de secuenciación bidireccionales con
el primer FW y RV de cada exón descartando falsos positivos
o secuencias artificiales por degradación del ADN o mal
procesamiento preanalítico
College of American Pathologists http://www.cap.org/apps/cap.portal
Ejemplo del exón 19
G
729
acgtcttccttctctctctgtcatag gga
I
732
att
P
733
cca
E
734
gaa
G
735
ggt
E
736
gag
K
737
aaa
V
738
gtt
K
739
aaa
V
742
gtc
A
743
gct
I
744
atc
K
745
aag
E
746
gaa
L
747
tta
R
748
aga
E
749
gaa
A
750
gca
T
751
aca
S
752
tct
P
753
ccg
K
754
aaa
A
755
gcc
N
756
aac
K
757
aag
E
758
gaa
I
759
atc
L
760
ctc
D
761
gat
762
gtg
763
agt
764
ttc
tttgctgtgtgggggtccatggctctgaacctcaggcccaccttttct
Laboratorio Oncogen S.R.L.
L
730
ctc
W
731
tgg
I
740
att
P
741
ccc
765
tgc
Exón 20 EGFR - R803W – CGG-TGG
Arginina-triptófano
T
Arginina-triptofano
Imagen cortesía del Laboratorio Oncogen S.R.L.
R803W
CGG-TGG
La mutación como paradigma en el
análisis del EGFR en el CPCNP
Es estudiar a todo paciente sin excluirlos
basándose en características clínicas como:
•
•
•
•
Etnia
Sexo
Edad
Historia del hábito de fumar
Zorrilla AF, et al. J Clin Oncol. 2012;30(Suppl):Abstract e18114.
Gracias por su participación en
esta actividad.
Descargar

Document