Caracterización molecular de
Mycoplasma gallisepticum y
Mycoplasma synoviae en
ponedoras comerciales y
reproductoras pesadas de la
zona centro de Colombia
Cesar Enrique Ventura Politte, MV
Maestría Salud Animal
Línea de Microbiología y Epidemiologia Aviar
CONTENIDO
Generalidades de la micoplasmosis
Mycoplasma gallisepticum y
Mycoplasma synoviae mediante la técnica de PCR
Detección
de
a partir de hisopos traqueales
Diferenciación molecular mediante la técnica de
PCR-RFLP de Mycoplasma gallisepticum vacunal y
de campo
Análisis molecular de Mycoplasma gallisepticum y
Mycoplasma synoviae
Conclusiones y Recomendaciones
Generalidades de la micoplasmosis
Mycoplasma gallisepticum y
Mycoplasma synoviae mediante la técnica de PCR
Detección
de
a partir de hisopos traqueales
Diferenciación molecular mediante la técnica de
PCR-RFLP de Mycoplasma gallisepticum vacunal y
de campo
Análisis molecular de Mycoplasma gallisepticum y
Mycoplasma synoviae
Conclusiones y Recomendaciones
HISTORIA
• 1898 en bovinos pleuroneumonia
• En aves en los años 30- Sinusitis de
los pavos en 1938
• Años 50, en pollos y pavos-ERC
Nocard y Roux, 1898; Nelson 1935; Dickinson y Hinshaw, 1938; Delaplane y
Stuart, 1943;Markham y Wong, 1952; Van Roekel y Olesiuk, 1953
ETIOLOGÍA
•
•
•
•
•
•
Clase Mollicutes (mollis = suave y cutes = pared),
Orden Mycoplasmatales
Familia Mycoplasmataceae
Género Mycoplasma
23 especies pueden afectar aves
Mycoplasma gallisepticum, Mycoplasma
sinoviae, Mycoplasma meleagris y Mycoplasma
iowa
Kleven, 2000
Browning & Markhan, 2004
GENOMA DE MG
600-1350 kpb, con
23-40 % de G-C,
740 genes.
Funciones claras
469 genes.
Papasizi et al., 2003
EPIDEMIOLOGÍA
Distribución mundial
Problemática de pollos, ponedoras,
reproductoras y pavos
Aves silvestres y de traspatio
OIE, 2004;Kleven, 2006
EPIDEMIOLOGÍA
Transmisión Horizontal y Vertical
Condiciones de granja: alimento,
roedores, agua
Reservorios y transmisores: Personas,
vehículos, Polvo, Insectos y Biofilms
Bioseguridad
Kleven, 1996; Christensen, et al., 1994; Butcher, 2008
PATOGENICIDAD
Citoadhesinas – Hemaglutininas:
mgc2, vlhA , GapA , PvpA
Perfil antigénico variable
Son organismos intracelulares
"Latencia "
Buyuktanir, et al., 2008; Razin, et al., 1998
DIAGNÓSTICO
IgM
7-10 DPI
IgG
15-21 DPI
Bencina et al., 1987;Bradbury & McClenaghan, 1982; Mardassi et al., 2008
Confirmatoria
Serotipificación
Detección del material
genético - ADN
Bencina et al., 1987;Bradbury & McClenaghan, 1982; Mardassi et al., 2008
Generalidades de la micoplasmosis
Mycoplasma gallisepticum y
Mycoplasma synoviae mediante la técnica de PCR
Detección
de
a partir de hisopos traqueales
Diferenciación molecular mediante la técnica de
PCR-RFLP de Mycoplasma gallisepticum vacunal y
de campo
Análisis molecular de Mycoplasma gallisepticum y
Mycoplasma synoviae
Conclusiones y Recomendaciones
DISTRIBUCIÓN GEOGRAFICA AVICULTURA NACIONAL
63 Granjas de Ponedoras
Comerciales – GPC
9,5 % del Censo
145 Lotes
30 Granjas de Reproductoras
Pesadas- GRP
33 % del Censo
48 Lotes
MINISTERIO DE AGRICULTURA Y DESARROLLO RURAL
DEPARTAMENTO ADMINISTRATIVO NACIONAL DE ESTADÍSTICADANE
FEDERACIÓN NACIONAL DE AVICULTORES DE COLOMBIA-FENAVI
FONDO NACIONAL AVÍCOLA-FONAV
ENCUESTA
Ubicación geográfica
Tamaño y número de lotes en la granja
Uso de vacunas de MG y MS
Edad – Raza – Granjas Cercanas
Tipo de Explotación y Tipo Instalación
Programa de Bioseguridad
MATERIALES Y MÉTODOS
• Enero de 2010 y marzo de 2012.
• Hisopos traqueales
MATERIALES Y MÉTODOS
• 45 animales por cada uno de los lotes
presentes en las granjas
• Un hisopo humedecido en PBS por cada
tres aves.
MATERIALES Y MÉTODOS
• Lavado del total de hisopos como un pool.
• Conservación en un recipiente estéril a -20 0C
• Extracción por un procedimiento no fenólico
Modificado de Hernández et al., 2009;
OIE, 2008
Primers
Secuencia
Gen
Producto
MG-F
MG-R
5' CGC AAT TTG GTC CTA ATC CCC AAC A 3' mgc2 237 pb
5' TAAACC CAC CTC CAG CTT TAT TTC C 3'
300 pb
MS-F 1
MS-R 1
5´ CCA TTG CTC CTG CTG TTA T 3´
5´ GAT TCT GTT GTA GTT GCT TCA A 3´
vlhA
300 pb
MS-F 2
MS-R 2
5´ AGT AAC CGA TCC GCT TAA TGC 3´
5´ GAT GCG TAA AAT AAA AGG AT 3´
vlhA
450 pb
28S-F
28S-R
5´ GGC GAA GCC AGA GGA AAC T 3
5´ GAC GAC CGA TTT GCA CGT C 3´
28S
61 pb
García et al., 2005; Wetzel et al., 2010; Hammond et al., 2009; Suzuki et al., 2009
ANÁLISIS ESTADÍSTICO
• Estadística descriptiva para las
diferentes variables
• Pruebas de correlación de variables
chi cuadrado
• Pruebas de regresión logística
• Software estadístico Statistix 8.0
Mycoplasma gallisepticum
POS NEG
Cepa Cepa
F 6/85
300 pb
300 pb
Mycoplasma synoviae
300 pb
WVU1853
300 pb
300 pb
POS NEG
450Pb
WVU1853
500 pb
POS NEG
450 pb
SENSIBILIDAD Y ESPECIFICIDAD
Cepa 6/85
Cepa F
300 pb
200 pb
Cepa
WVU1853
Cepa
WVU1853
300 pb
Alto porcentaje de positividad a
MG y MS
80
60
MG
MS
51,81
48,18
40
30,05
20
0
POS
1
NEG
0
Porcentaje
69,94
n : 193
Mayor positividad a MS en los dos tipos de
explotación
Positividad a MG y MS
100
77,9
80
57,2
60
45,8
40
20,8
20
0
G
PC
P
p<0,05
G
R
Porcentaje
MS
MG
Variables sin diferencias estadísticas
GPC
Ponedoras
comerciales
GRP
Reproductoras
Pesadas
Altitud
268-2780 m.s.n.m
p>0,05
1010-2572 m.s.n.m
p>0,05
Tamaño de los
lotes
1000 – 121380 aves
p>0,05
770 – 36300 aves
p>0,05
Departamento
p>0,05
p>0,05
Tipo de
Instalación
p>0,05
p>0,05
Bioseguridad
Cumplimiento de
6 parámetros
61,8 %
p>0,05
100 %
Variables con diferencias estadísticas
GPC
GRP
Raza
5 Razas
p<0,05 en MG 20 – 73 %
p<0,05 en MS 60 – 91 %
2 razas
p<0,05 en MG 4 – 36 %
p<0,05 en MS 39 – 52 %
Grupos Etáreos
p<0,05 MG 13% al 74 %
p<0,05 MS 13 % al 94%
p<0,05 MG 17% al 33 %
p<0,05 MS 17% al 100%
Numero de lotes
1 – 10 p>0,05 en MS
p<0,05 para MG 40% 83%
1 - 3 lotes
p>0,05
USO de Vacunas
MG y MS
35,2 % MG p>0,05
0% MS
91,7 % MG p>0,05
0%
Mayor positividad mixta en Ponedoras Comerciales
Infecciones Mixtas MG y MS
Porcentaje
60
55,2
GPC
GRP
40
20
8,3
0
POS MG y MS
Generalidades de la micoplasmosis
Mycoplasma gallisepticum y
Mycoplasma synoviae mediante la técnica de PCR
Detección
de
a partir de hisopos traqueales
Diferenciación molecular mediante la técnica de
PCR-RFLP de Mycoplasma gallisepticum vacunal y
de campo
Análisis molecular de Mycoplasma gallisepticum y
Mycoplasma synoviae
Conclusiones y Recomendaciones
Cepas MG
Cepa F
Cepa
6/85
Cepa R
Sitios de corte HaeIII en el gen mgc2 de MG
TCGCAATTTGGTCCTAATCCCCAACAAAGAATTAATCCACAGGGTTTT
GGTGGCCCAATGCCACCTAACCACATGGGGATGCGGCCAGGGTTTA
ACCAAATGCCGCCACAAATGGGTGGGATGCCACCTAACCACATGGG
GATGCGGCCAGGGTTTAACCAAATGCCACCTAACCAAATGGGTGGA
ATGCCACCAAGACCAAACTTCCCTAACCAAATGCCTAATATGAATCAA
CCAAGACCAGGTTTCAGACCACAACCTGGTGGTGGGGTCTCGATGG
GAAATAAAGCTGGAGGTGGGTTTAAA
TCGCAATTTGGTCCTAATCCCCAACAAAGAATTAACCCGCAGGGCTT
TGGTGGCCCAATGTCACTTAACCAAATGGGGATGCGACCAGGGTTTA
ACCAAATAGCCCCCACAAATGGGAGGAATAGCCACCAAGACCAAAC
TTCCCTAACCAAATAGCCTAATATGAACCAACCAAGACCAGGTTTCAG
ACCACAACCTGGTGGTGGGGCGCCGATGGGAAATAAAGCTGGAGG
TGGG
CGCAATTTGGTCCTAATCCCCAACAAAGAATTAACCCACAGTGCTTT
GGTGGCCCAATGCAACCTAACCAAATGGGAATGCGACCAGGGTTTA
ACCAAATGCCCCCACAAATGGGAGGAATGCCACCTAACCAAATGGG
AATGCGACCAGGGTTTAACCAAATGCCCCCACAAATGGGAGGAATG
CCACCAAGACCAAACTTCCCTAACCAAATGCCTAATATGAACCAACC
TAGACCAGGTTTCAGACCACAACCTGGTGGTGGGGTGCCGATGGGA
AATAAAGCTGGAGGTGGGTTTA
Longitud de los
Fragmentos
31 pb
53 pb
63 pb
157 pb
53 pb
184 pb
52 pb
248 pb
Acceso Genbank AY556230.1; AY556231.1 y AY556228.1
PCR-RFLP para diferenciar cepas de
MG
MG 300
HaeIII
MG 237
157
248
184
63
52
53
53
31
Cepa
F
Campo
6/85
www.insilico.ehu.es
Lectura de Patrones de restricción
para M. gallisepticum
ROJO: Patrón 1
AMARILLO: Patrón 2
Identificación de patrones RFLP de
MG con Tinción de plata
Control
Cepa
F
300pb
200pb
160pb
100pb
60pb
40pb
Control Muestra Muestra Muestra
Cepa
con
con
con
6/85 Patrón Patrón Patrón
1
1
2
Mayor porcentaje de cepas de campo de
MG
Patrones RFLP de MG
80
Porcentaje
60,2
Patron 1
Patron 2
60
39,8
40
20
0
n:93
POS MG
Sin diferencias estadísticas
Patrón 1
Patrón 2
Altura
p>0,05
p>0,05
Número de lotes en las
granjas
p>0,05
p>0,05
Tamaño de los lotes
p>0,05
p>0,05
Departamento
p>0,05
p>0,05
Bioseguridad cumplimiento
de 6 parámetros
p>0,05
p>0,05
Con diferencias estadísticas
Patrón 1
Raza
Patrón 2
p<0,05
p<0,05
7 – 40 % GPC
2 – 53 % GPC
Tipo de
Instalación
p<0,05
p<0,05 Jaulas 5-9 %-
Tipo de
Explotación
p<0,05
p<0,05
30% GPC- 90% GRP
70% GPC- 10 % GRP
Jaulas 22% - Piso 57% Piso 86 %
Generalidades de la micoplasmosis
Mycoplasma gallisepticum y
Mycoplasma synoviae mediante la técnica de PCR
Detección
de
a partir de hisopos traqueales
Diferenciación molecular mediante la técnica de
PCR-RFLP de Mycoplasma gallisepticum vacunal y
de campo
Análisis molecular de Mycoplasma gallisepticum y
Mycoplasma synoviae
Conclusiones y Recomendaciones
Secuenciación de 80
muestras
seleccionadas
MG
34 muestras
Patrón 1
12 muestras
Patrón 2
22 muestras
MS
46 muestras
Única Banda
36 muestras
Doble banda
10 muestras
Similaridad de las secuencias de MG
Patrón 1
Patrón 2
96-100 %
Entre ellas
96-100 %
entre ellas
96-99% con
la Cepa F
96-98 % cepa R
de referencia
Cepa F control 98%
y 100% Eis7C10
www.ncbi.nlm.nih.gov/BLAST
Acceso Genbank AY556230.1 , HQ591358.1, AY556228.1
Patrón 1 en Muestras de campo
16.6
16
14
_________________
AY556230.1
Strain F.s eq
MG189.seq
_________________
HQ591358.1
Eis7-C-10.seq
MG20.seq
MG61.seq
MG86.seq
MG126.seq
MG27.seq
CepaF.s eq
MG13.seq
MG7.s eq
MG69.seq
MG172.seq
MG12.seq
_________________
AY556231.1
Strain 685.seq
_________________
Vacuna
6-85.s eq
12
10
8
6
4
2
0
Nucleotide Substitutions (x100)
Tamura, Peterson, Stecher, Nei, and Kumar 2011 MEGA 5.1
Seqman® DNASTAR, Lasergene v.10®
MG54.seq
MG139.seq
MG142.seq
MG149.seq
MG143.seq
MG85.seq
MG94.seq
AY556229.1 Strain S6.seq
MG186.seq
MG22.seq
MG29.seq
MG46.seq
MG190.seq
MG194.seq
MG156.seq
AY556228.1 strain R.s eq
_________________
MG165.seq
MG70.seq
MG89.seq
MG72.seq
MG75.seq
MG201.seq
_________________
AY556230.1 Strain F.s eq
AY556231.1 Strain 685.seq
_________________
Patrón 2 en Muestras de campo
23.4
20
15
10
Nucleotide Substitutions (x100)
5
0
Seqman® DNASTAR, Lasergene v.10®
Tamura, Peterson, Stecher, Nei, and Kumar 2011 MEGA 5.1
Similaridad de las secuencias de MS
Se escogieron un grupo de cepas con mas alto
porcentaje de similaridad en BLAST
83,2 % - 96,9 %
Entre ellas
40-99 % En
muestras de
doble banda
www.ncbi.nlm.nih.gov/BLAST
Genbank HQ326484.1; DQ661614.1; FM164370.1; AB507391.1 ; FJ495803.1
Similaridad de las secuencias de MS
Cepa WVU1853 : 38,9 % - 43,8 %
Cepa NZMSID181: 82 % – 98 %
Cepa B45/04: 88 % - 95 %
Cepa 94011: 89 % - 96 %
Cepa EEA: 82 % - 97 %
www.ncbi.nlm.nih.gov/BLAST
Genbank HQ326484.1; DQ661614.1; FM164370.1; AB507391.1 ; FJ495803.1
MS30.seq
MS21.seq
MS101.seq
MS12.seq
MS142.seq
MS149.seq
MS87.seq
_________________
FM164370.1
Strain B45 04.seq
MS51.seq
_________________
AB507391.1
Strain NZMSID181.seq
DQ661614.1
Strain 94011.seq
_________________
MS134.seq
_________________
FJ495803.1
Strain EAA.seq
MS62.seq
Productos de MS de
una sola banda
MS43.seq
_________________
HQ326484.1 WVU1853.seq
77.7
70
60
50
40
30
Nucleotide Substitutions (x100)
20
10
0
Seqman® DNASTAR, Lasergene v.10®
Tamura, Peterson, Stecher, Nei, and Kumar 2011 MEGA 5.1
MS28.seq
MS190-1.seq
MS37.seq
MS37-1.seq
MS104.seq
MS104-.seq
MS60-.s eq
MS76-1.seq
AB507391.1 Strain NZMSID181.seq
_________________
MS194.seq
MS28-1.seq
MS76.seq
_________________
FM164370.1 Strain B45 04.seq
_________________
FJ495803.1 Strain EAA.seq
MS194-1.seq
MS52-1.seq
_________________
DQ661614.1 Strain 94011.seq
MS52.seq
MS60.seq
HQ326484.1 WVU1853.s eq
_________________
Productos de MS de
dos bandas
58.1
50
40
30
20
Nucleotide Substitutions (x100)
10
0
Seqman® DNASTAR, Lasergene v.10®
Tamura, Peterson, Stecher, Nei, and Kumar 2011 MEGA 5.1
Generalidades de la micoplasmosis
Mycoplasma gallisepticum y
Mycoplasma synoviae mediante la técnica de PCR
Detección
de
a partir de hisopos traqueales
Diferenciación molecular mediante la técnica de
PCR-RFLP de Mycoplasma gallisepticum vacunal y
de campo
Análisis molecular de Mycoplasma gallisepticum y
Mycoplasma synoviae
Conclusiones y Recomendaciones
CONCLUSIONES
• Alta presencia de MG y MS de campo
en los dos tipos de explotación en
estudio.
• Mayor presencia en granjas multiedad
y mayor edad de los lotes
• Posibilidad de Transmisión Vertical
CONCLUSIONES
• Infecciones mixtas que afectan el
manejo farmacológico y vacunal de lo
agentes a nivel de granja
• Se debe determinar el uso y la
importancia del uso de vacunas para
el control de la enfermedad en las
granjas
RECOMENDACIONES
• Estudios que involucren todas las etapas de
producción en los diversos tipos de
explotación
• Evaluación de programas vacunales
• El mismo tipo de estudio en otras zonas
avícolas del país
• Evaluar interacción de micoplasmas con
otros patógenos respiratorios
Descargar

documento ESP