BIOINFORMATICA APLICADA A LAS CIENCIAS BIOLÓGICAS Y BIOMÉDICAS
PROYECTO DE EXTENSIÓN Nº 1410
Dirección de Extensión UA
FACULTAD DE CIENCIAS DE LA SALUD
DEPARTAMENTO DE TECNOLOGIA MÉDICA
Y
FACULTAD DE CIENCIAS BASICAS
DEPARTAMENTO DE MATEMATICAS
5 - 9 JULIO 2010, Universidad de Antofagasta. Antofagasta
Charla inaugural: mutación y evolución en 20 años (casi, en estricto rigor 21 años)
Eliseo Martínez H.
1989
gnome
genome
En una ceremonia de entrega de las Medallas Nacionales de Ciencia y Técnica, celebrada en la Sala
Oriental de la Casa Blanca, Bush expuso con orgullo todo lo que su gobierno y el de su predecesor Reagan
habían hecho por la ciencia: la estación espacial, el (ahora difunto) Supercolisionador superconductor y la
iniciativa del "Gnomo" (en inglés gnome) humano. No hizo ademán alguno de rectificar. Nadie pestañeó. No
se produjo en la sala ni una sonrisa disimulada ni un murmullo…
26 de junio de 2001
gEnome
La Biblioteca de Alejandría
BIOINFORMATICA APLICADA A LAS CIENCIAS BIOLÓGICAS Y BIOMÉDICAS
PROYECTO DE EXTENSIÓN Nº 1410
Dirección de Extensión UA
FACULTAD DE CIENCIAS DE LA SALUD
DEPARTAMENTO DE TECNOLOGIA MÉDICA
Y
FACULTAD DE CIENCIAS BASICAS
DEPARTAMENTO DE MATEMATICAS
5 - 9 JULIO 2010, Universidad de Antofagasta. Antofagasta
Charla inaugural: mutación y evolución (solo necesitamos la multiplicación)
Eliseo Martínez H.
DNA Mutation Rates and Evolution
…the average mutation rate for eukaryotes in general is estimated to be
about 2.2 x 10-9 mutations per base pair per year(1).
Entonces la tasa de mutación de una doble hebra
de longitud de 50.000 pb es de
50.000 pb
=
0.00011 mutaciones por año
With a 20 year average generation time for humans, this works out to be
around 4.4 x 10-8 mutations per base pair per generation.
=
20 años
4.4*10-8 mutaciones por pares de bases por
generación
(1). Sudhir Kumar, Sankar Subramanian, Mutation Rates in Mammalian Genomes, PNAS, January
22, 2002, Vol. 99, No. 2, p. 803-808. (www.pnas.org/cgi/doi/10.1073/pnas.022629899 )
Since most estimates of the size of the diploid human genome run around 6.3
billion base pairs, this mutation rate would give the average child around 277
mutational differences from his or her parents
=
…TTACTTTTACCACAAGCGCGCGCGCTAATAGCGCTAGCTAG…
…TTAGTTTAACCACAAGCGCGCGCGCTAATAGCGCTAGCTAG…
En promedio habrá 277 diferencias
en el texto del genoma entre el hijo
y su padre o madre
This sounds like quite a high number and it is in fact on the high end of the spectrum
when compared to studies looking more specifically at human mutation rates verses
eukaryotic mutation rates in general.
277 mutaciones de generación en genación es una cota superior respecto de otros
estudios
Using (…) sequence comparisons, "The average mutation rate was estimated to be
~2.5 x 10-8 mutations per nucleotide site per generation or 175 mutations per diploid
genome per generation" [Based on a higher diploid genome estimate of 7 billion base
pairs]. (2)
=
…TTACTTTTACCACAAGCGCGCGCGCTAATAGCGCTAGCTAG…
…TTAGTTTAACCACAAGCGCGCGCGCTAATAGCGCTAGCTAG…
En promedio habrá 175 diferencias
en el texto del genoma entre el hijo
y su padre o madre
(2). Nuchman, Michael W., Crowell, Susan L., Estimate of the Mutation Rate per Nucleotide in Humans,
Genetics, September 2000, 156: 297-304 (http://www.genetics.org/cgi/content/full/156/1/297? )
These non-direct mutation rate estimates might actually seem reasonable given that they seem to match the error rates of DNA
replication that occur between the formation of a zygote in one generation and the formation of a zygote in the next generation
In the illustration(3) below, notice that from fertilization to the formation of a woman's first functional
gamete, it takes about 23 mitotic divisions. Men, on the other hand, contribute about twice as many germ
line mutations as women do.(4) At least part of the reason is that their stem cells keep dividing so that the
older a man gets before having children more mitotic divisions occur.
(3) http://www.nature.com/cgitaf/DynaPage.taf?file=/nrg/journal/v1/n1/full/nrg1000_04
0a_fs.html
(4) http://www.ornl.gov/hgmis/project/info.html
Now, consider that each diploid fertilized zygote contains around 6 billion base pairs of
DNA (~3 billion from each gamete/parent, using a conservative round number).(5) From
cell division to cell division, the error rate for DNA polymerase combined with other
repair enzymes is about 1 mistake in 1 billion base pairs copied.(6) At this rate, there are
about 6 mistakes with each diploid cell replication event. With a male/female average of
29 mitotic divisions before the production of the next generation, this works out to be
about 175 mutations per generation.
220 millones pb
Meiosis de la
mujer
Meiosis del
hombre
24  34
 29
2
Aprox. 6 billones de pb.
29 meiosis antes de la
producción de la nueva
generación
Un error (aprox.) por cada billón de pb.
6 errores (aprox.) en la replicación
Casi 175 mutaciones
por generación
Un error (aprox.) por cada 10 billones de pb (7)
(5) http://www.bgsu.edu/departments/chem/midden/chem308/slides/DNARBW.pdf
(6) http://info.bio.cmu.edu/courses/03231/LecF02/Lec18/lec18.html
(7) http://www.blc.arizona.edu/marty/411/Modules/mod6.html
29 * 6  174
Casi 17 mutaciones
por generación
Imperfección y evolución
Si las mutaciones son benéficas para la especie y son primadas por la selección natural, se
extenderán por la población, quedando perennizado el error inicial que se convertirá así en la nueva
norma. La selección natural actúa sobre caracteres surgidos por azar tras mutaciones fortuitas. Los
errores de la duplicación genética constituyen los procesos básicos de la evolución. Todas las
realizaciones de la materia viva que observamos hoy y todas las que han existido en el pasado, del
vegetal al animal, de la bacteria a la inteligencia humana, pasando por las flores más llamativas, o los
dinosaurios más espectaculares, han sido frutos de imperfecciones en el funcionamiento genético.
Sin ellas, la vida no hubiera podido evolucionar y hubiera permanecido en un mismo estadio primitivo,
en el que unas mismas moléculas se reproducirían idéntica y perpetuamente.
Louis de Bonis. Universidad de Poitiers
Investigación y Ciencia, octubre de 1994
MT-Polimerasa
Un estudiante preguntó: “¿esta máquina no se equivoca nunca?”. No, fue mi respuesta. En efecto, por larguísima que
sea la hebra de ADN esta máquina encontrará (sin razonamiento alguno) la hebra complementaria.
Epílogo: Con mucha fortuna la enzima polimerasa, junto a las enzimas que le colaboran, se
equivoca… (muy poco, pero lo suficiente para seguir siendo la “especie elegida”)
Descargar

Diapositiva 1