Técnicas de
Biotecnología
Métodos de detección, identificación
y cuantificación de moléculas en
Recombinación de ADN
Objetivo
• Conocer las diversas técnicas para detección, identificación
y cuantificación de:
– ADN,
– RNA y
– Proteínas
Determinación de la presencia de organismos
modificados genéticamente (OGM)
1. Colecta de las muestras a analizar
• OGM
2. Homogeneización de las muestras.
• Liberación de los componentes celulares por lisis.
3. Adición de amortiguadores específicos para el
aislamiento de ADN, de ARN o de proteínas.
• Separar las moléculas de muestras complejas.
• Evitar la degradación de las moléculas.
Determinación de la presencia de organismos
modificados genéticamente (OGM)
4. Detección de ADN, de ARN o de proteínas transgénicas:
•
•
•
ADN.
• Amplificación por PCR de secuencias blanco.
• Detección por Southern blot de secuencias blanco.
ARN.
• Amplificación por RT-PCR de secuencias blanco.
• Detección por Northern blot de secuencias blanco.
Proteínas.
• Western Blot
• ELISA.
5. Identificación y cuantificación de la molécula
detectada.
6. Interpretación y reporte de resultados.
Aspectos de la Cuantificación
• Muestreo y preparación de la muestra
– El procedimiento determina la representatividad del resultado
– Evaluar el tamaño de la muestra, su homogeneidad y el umbral
• Deben cumplirse requerimientos estadísticos
– Las matrices requeridas dependerán del tipo de material
Métodos de análisis basados en la
detección de proteínas
1. Los transgenes codifican proteínas nuevas
2. Las técnicas inmunológicas utilizan anticuerpos
–
–
Ideales para necesidades cualitativas y cuantitativas
Detectan proteínas específicas en matrices complejas
•
•
2.1
–
Anticuerpos policlonales
El reconocimiento es muy sensitivo pero es menos
específico
2.2
–
El analito debe ser conocido
Puede haber interferencia por interacciones no específicas
con otras proteínas, con sulfactantes (saponinas), con
fenoles, con ácidos grasos y con fosfatasas
Anticuerpos monoclonales
El reconocimiento es altamente específico, pero es
menos sensible
La técnica de “Western Blot”
• Prueba cualitativa altamente específica
• Puede determinar si hay niveles por debajo o superiores
al umbral mínimo de OGM (~0.8 – 5%).
• Es utilizada principalmente en investigación
1. Usar electroforesis desnaturalizante SDS-PAGE
– Solubiliza y remueve agregados y proteínas
adventicias
+
La Electroforesis
• El principio de la electroforesis de proteínas
(intactas) se basa en su carga neta y en su
habilidad para migrar dentro de una matriz
gelatinosa (poliacrilamida “proteínas” o agarosa
“ADN o RNA”).
• Se aplica una corriente eléctrica a la mezcla de
proteínas por un período de tiempo hasta que
las proteínas migren y se separan o fraccionen
con base en su tamaño.
SDS - PAGE
Glu
Asp
Ala
Gln
Phe
Lys
Al final, las proteínas quedan separadas
por su tamaño
Escalera de
masas moleculares
La técnica de “Western Blot”
2. Las proteínas fraccionadas en el gel son
entonces transferidas a una soporte sólido
(nitrocelulosa o PVDF)
La técnica de “Western Blot”
3.
Bloquear el soporte (con leche descremada)
Enjuagar con H2O
bidestilada
Adicionar
anticuerpos
primarios
Enjuagar
nuevamente
Los anticuerpos se unirán a proteínas
específicas
4. Adicionar anticuerpos secundarios,
dirigidos contra los anticuerpos
primarios y unidos a una enzima
5. Revelar la reacción para desarrollar el color
Deben apreciarse bandas teñidas con el
color de la reacción revelada por la
enzima unida al anticuerpo secundario
La técnica de “Western Blot”
Anticuerpo primario
(dirigido contra una proteína específica)
Anticuerpo secundario
(dirigido contra el anticuerpo primario)
Ensayo de ELISA en microplaca
(Enzyme-Linked Immuno Sorbent Assay)
El ensayo se desarrolla en microplacas cubiertas con anticuerpos.
Es un ensayo cuantitativo, altamente sensible, económico,
permite el manejo de muestras múltiples e ideal para análisis
de laboratorio
Se requiere que la proteína esté desnaturalizada
Anticuerpo
primario,
específico para
el antígeno
Ac secundario
marcado dirigido
contra el Ac
primario
pozo
Proteína
bloqueadora
Antígeno
Respuesta
colorida,
dependiente de la
concentración de
OGM
Placa de ELISA
Ensayo de tira de flujo lateral
Muestra
Proteína Bt
Línea de
prueba
Línea
control
Barra 1
Anticuerpo
anti Bt
Barra 2
Anticuerpo
anti Bt
Barra 3
Anticuerpo
no específico
Marcado
No fijo
No marcado
Fijo
No marcado
Fijo
Ahmed, 2002
Ensayo de tira de flujo lateral
Línea
control
• Es una variante del método de
ELISA, los anticuerpos
inmovilizados, específicos para las
proteínas GM son acoplados a un
reactivo colorido e incorporados
en tiritas de nitrocelulosa.
Línea
de
prueba
• Es rápido, económico, portátil y
bueno para ensayos iniciales.
Resultado
negativo
Resultado
positivo
Ahmed, 2002
Métodos basados en el ADN
• Se basa en la complementariedad de las
hebras del ADN, que hibridan en una
manera dependiente de la secuencia
• El ADN transgénico posee diversos
elementos únicos en los cultivos
promotor 35S
CaMV
Gen codificante
terminador NOS
Agrobacterium tumefaciens
•Los elementos típicamente presentes en el ADN transgénico son: una
secuencia promotora (35S), un gen estructural y una señal de
terminación de la transcripción (NOS)
Componentes básicos de
genes transferidos
- El ADN transferido por métodos biotecnológicos
consiste básicamente en tres componentes.
- Una secuencia que regula la transcripción del gen
codificante (promotor).
- El gen codificante.
- Una secuencia que marca el fin de la transcripción.
ADN, preparación de la muestra
Requerimientos para la extracción de ADN
– La muestra de laboratorio debe ser representativa de la muestra del
campo o de la muestra alimentaria
– Tener entre 100 y 350 mg
– Debe tener una alta calidad
• El tamaño completo y libre de daños en la secuencia
– Efectos adversos por el calor, bajo pH, nucleasas, despurinización,
degradación enzimática, etc.
– ADN de alta pureza
• Se afecta por contaminación de las matrices alimentarias
– Polisacáridos, lípidos, polifenoles y químicos de la extracción del ADN
Requerimientos para la extracción
de ADN
• Ruptura de las paredes celulares
– Con hielo seco o con nitrógeno líquido
• Desintegración de las membranas celulares
– Con detergentes como el CTAB o el SDS
• Inactivación de nucleasas
– Adicionar EDTA (une Mg2+) y proteasas
• Separación de polisacáridos inhibitorios
• Separación de componentes celulares hidrofóbicos
– E.g.. Lípido y polifenoles
• Separación del ADN del detergente, por medio de
precipitación con alcohol
Southern Blot
La técnica de la hibridación del DNA, o Southern blot, se basa en
el hecho de que dos cadenas complementarias se alinearán y
formarán un híbrido.
1. Comienza con el corte del ADN GM por medio de enzimas de
restricción.
2. El DNA cortado se fracciona por electroforesis en un gel de
agarosa.
3. El DNA fraccionado se transfiere a un soporte sólido.
4. El DNA fraccionado se hibrida en el soporte con una sonda
marcada.
• Radiactividad.
• Digoxigenina.
5. La membrana hibridada se expone a una película
1. Corte del DNA con enzimas de restricción.
Las enzimas de restricción cortan al DNA en sitios específicos, de
tal manera que se generan segmentos de DNA de tamaños definidos
2. El DNA cortado se fracciona por electroforesis en un gel de
agarosa.
Herbert Boyer inventó una técnica para fragmentar al DNA, la electroforesis en gel.
En esta técnica, se aplica corriente eléctrica en los extremos de un gel en donde se
han depositado muestras de DNA, de tal manera que las moléculas de DNA cargadas
negativamente se desplazan hacia el electrodo positivo (ánodo) y pueden separarse en
función de su tamaño.
Ánodo
Cátodo
+
Solución
amortiguadora
Gel de
agarosa
3. El DNA cortado se fraccionado se transfiere a un soporte sólido.
•
•
Por capilaridad.
Por aplicación de corriente eléctrica
Pesa
Papel
absorbente
Soporte sólido
(nylon)
Papel
Whatman
Gel
Solución
4. El DNA fraccionado se hibrida en el soporte con una sonda
marcada
5. La membrana hibridada se expone a una película.
Sonda marcada con fósforo
radiactivo [a-32P]dCTP
Principios de la PCR
• Permite la amplificación exponencial de una
secuencia blanco de ADN.
• La ADN polimerasa hace copias exactas del
templado.
• Se requieren cebadores sintéticos que:
– Se localizan en los bordes de la secuencia
deseada.
– Son complementarios a la secuencia del
ADN transgénico.
• El número de copias de la secuencia blanco
crece exponencialmente.
– En teoría…
Cycles
1
2
3
4
5
6
7
8
9
10
11
12
13
14
15
16
17
18
DNA molecules formed
1
2
4
8
16
32
64
128
256
512
1,024
2,048
4,096
8,192
16,384
32,768
65,536
Construcción Génica
Promotor
(señal de inicio)
Terminador
(señal de terminación)
P
T
Gen codificante de una
nueva característica
En la tanscripción se produce
un ARN mensajero, copia fiel
del gen original
AAAAAAAA
En la traducción se produce una
cadena de aminoácidos o proteína
Construcción Génica
Promotor
(señal de inicio)
Terminador
(señal de terminación)
Gen codificante de una
nueva característica
Las secuencias blanco para la detección por PCR de secuencias de
ADN de OGM en plantas, tienen el siguiente orden de
especificidades:
1 = baja especificidad; 4 = evento específico de la transformación
Confirmación de la identidad del
ADN que se ha sintetizado por
medio de PCR
• Verificación del tamaño por electroforesis en gel de agarosa.
Problema: Artefactos
del mismo tamaño
darían lugar a falsos
positivos.
(–)
(–)
(–)
(+)
(+)
(+)
• Verificación del tamaño por medio de ensayos de Southern Blot.
Problema: Ensayo apropiado pero un poco
tardado.
Transferencia de los
fragmentos de
restricción a un
filtro de nylon
Hibridación del
filtro con la
sonda radiactiva
Exposición del
filtro a una
película de
rayos X
Filtro
Gel
Fragmentos de
DNA. Hay
tantos que se
ve una sola
banda
Fragmentos de
DNA que ya se
transfirieron
al filtro de
nylon
La sonda
radiactiva
hibrida con el
DNA
complementar
io, pero no es
visible
todavía.
Las bandas
visible en la
película de
rayos X
significan que
la sonda
hibridó
Verificación del tamaño por medio de PCR anidado, con un
segundo par de cebadores
Verificación del tamaño por medio de PCR anidado, con un
segundo par de cebadores
La primera PCR se hace con cebadores externos (azul)
5’
3’
3’
5’
Primer amplicón
5’
3’
5’
3’
La segunda PCR se hace con cebadores internos (rojo)
5’
3’
3’
5’
5’ Segundo amplicón 3’
3’
5’
• Secuenciación. Es el único método que no da lugar a dudas.
GTA CGTA CGTA CGTA CGTA
GAGGCCTTCGGTTGCTTAGTAAGGAGCGGCCGTCCGGA
GAGGCCTTCGGTTGCTTAGTAAGGAGCGGCCGTCCGG
GAGGCCTTCGGTTGCTTAGTAAGGAGCGGCCGTCCG
GAGGCCTTCGGTTGCTTAGTAAGGAGCGGCCGTCC
GAGGCCTTCGGTTGCTTAGTAAGGAGCGGCCGTC
GAGGCCTTCGGTTGCTTAGTAAGGAGCGGCCGT
GAGGCCTTCGGTTGCTTAGTAAGGAGCGGCCG
GAGGCCTTCGGTTGCTTAGTAAGGAGCGGCC
GAGGCCTTCGGTTGCTTAGTAAGGAGCGGC
GAGGCCTTCGGTTGCTTAGTAAGGAGCGG
GAGGCCTTCGGTTGCTTAGTAAGGAGCG
GAGGCCTTCGGTTGCTTAGTAAGGAGC
GAGGCCTTCGGTTGCTTAGTAAGGAG
GAGGCCTTCGGTTGCTTAGTAAGGA
PCR en tiempo real (Cuantitativo)
• La amplificación exponencial por PCR se incrementa hasta
que se alcanza una meseta, esto ocurre entre 30 y 40
ciclos.
– Porque se limitan los componentes de la reacción.
– En esas etapas hay una pérdida de la precisión en la
cuantificación.
• Los
ensayos
de
RT-PCR
(para
detectar
ARN)
son
proporcionales al número de ciclos.
– Durante la fase exponencial del PCR.
– Se determina el número de ciclos en donde el producto sea igual
en cantidad al producto de la muestra OGM.
PCR en tiempo real (Cuantitativo)
Métodos basados en el ARN:
RT-PCR
• El ARN es transcrito a ADN complementario por
medio de una transcriptasa reversa aislada o
clonada de un virus como el del HIV.
• Se cuantifica por la presencia de pigmentos, por
medio de sondas fluorescentes y por la hidrólisis de
sondas
– Permite diferenciar los artefactos y los productos
verdaderos.
• Se requiere de una cantidad mínima de ARN como
sustrato.
– Es independiente del tamaño del genoma y del número de
copias del gen
• Se necesitan al menos 36 copias para detectar un transgen en una
muestra OGM.
Brodman et al., 2002
Resumen de los Métodos de detección de moléculas
transgénicas
Proteína
Parameter
ADN
Western blot
ELISA
QC-PCR
RT-PCR
Difficult
moderate
Simple
Difficult
Difficult
Difficult
Difficult
Yes
Yes
No
Yes
Yes
Yes
Yes
Sensitivity
High
High
High
Moderate
Very High
High
High
Duration
2d
30 - 90 min
10 min
6h
1.5d
2d
1d
Cost/sample
150
5
2
150
250
350
450
Quantitative
No
Yes
No
No
No
Yes
Yes
Field application
No
Yes
Yes
No
No
No
No
Field Testing
Academic lab
Test facility
Ease of use
Special equipment
needed
Where applied
Academic lab Test facility
Lateral flow strip Southern blot Qualitative PCR
ARN
Test facility Test facility
Ahmed, 2002
Ejemplos de métodos publicados para la determinación de grupos
derivados de OGM, agrupados de acuerdo con su especificidad en
plantas.
Target sequence
Reference
Method to detect plant derived DNA
Chloroplast tRNALeu gene (trnL) intron
Taberlet & al., 1991
Methods to detect specific plant species
Corn/maize single copy invertase gene
Ehlers & al., 1997
Soybean single copy lectin gene
Meyer & al., 1996
Tomato single copy polygalacturonase gene
Busch & al., 1999
Screening methods (category 1)
Cauliflower mosaic virus promoter (P-35S)
Pietsch & al., 1997
Nopaline synthase terminator (T-Nos)
Pietsch & al., 1997
Gene specific methods (category 2)
bar (phosphinotricin acetyltransferase) gene
Ehlers & al., 1997
CryIA(b) gene (synthetic)
Ehlers & al., 1997; Vaïtilingom &
al., 1999
Ejemplos de métodos publicados para la determinación de grupos
derivados de OGM, agrupados de acuerdo con su especificidad.
Construct specific methods (category 3)
Bt11 maize: junction alcohol dehydrogenase 1S intron IVS6 (enhancer) CryIA(b) gene
Matsuoka & al., 2001
Bt176 maize: junction CDPK (calcium dependent protein-kinase)
promoter - synthetic CryIA(b) gene
Hupfer & al., 1998
GA21 maize: OTP (enhancer) - epsps gene (RoundupReady tolerance)
Matsuoka & al., 2001
Mon810 maize: junction P-35S - heat shock protein (hsp) 70 intron I
(enhancer)
Zimmermann & al., 1998
Mon810 maize: junction hsp 70 intron - CryIA(b) gene
Matsuoka & al., 2001
RoundupReady®: junction P-35S - Petunia hybrida CTP (chloroplast
transit peptide)
Wurz & Willmund, 1997
T25 maize: junction pat (phospinotricin acetyltransferase) gene - T-35S
Matsuoka & al., 2001
Zeneca tomato: junction T-Nos - truncated tomato polygalacturonase
gene
Busch & al., 1999
Event specific methods (category 4)
Bt11 maize: junction host plant genome - integrated recombinant DNA
Zimmermann & al., 2000
RoundupReady® soybean: junction host plant genome - integrated
recombinant DNA
Berdal & Holst-Jensen, in press;
Taverniers & al., in press; Terry &
Harris, in press
Descargar

Detection Technology for Genetically Modified Crops for