QUIMICA BIOLOGICA
Lic. en Biol. Molec. e Ing. en Alim.
Bolilla 10 (Ing. en Alimentos): Acido desoxirribonucleico. ADN,
principales características estructurales. Proceso de replicación del
ADN, complejos enzimáticos que intervienen. Etapas. Concepto de
mutaciones y mutágenos. Procesos de reparación del ADN. Flujo de
la información genética: ARN. Tipos de ARN: mensajeros,
ribosomales y de transferencia, estructuras y funciones. Síntesis del
ácido ribonucleico: transcripción, enzimas que intervienen. Etapas.
Importancia de los procesos de maduración, intrones y exones.
Acidos Nucleicos:
Estructura molecular del ADN
Acido desoxiribonucleico (ADN)
1953. Watson, Crick y Wilkins
Representación esquemática de
la estructura helicoidal del ADN
Esqueleto
Azúcar-Fosfato
Esqueleto
Azúcar-Fosfato
Pares de Bases
3’
OH
5’
5’ 3’
F
A
T
Az
Az
F
F
G
Uniones Puente
Hidrógeno
C
Az
Az
F
F
G
Az
Az
Uniones Puente
Hidrógeno
3’ 5’
F
- a-hélice con giro a la derecha.
- Cadenas complementarias y
antiparalelas.
- Desoxinucleótidos de A, T, G, y C.
- G-C 50% más fuerte que A-T.
C
A
T
F
Az
Az
F
F
G
C
Az
Az
3’
F
HO
Nucleótido
5’
Disposición del ADN en los cromosomas
Fragmento de ADN
en doble hélice
Cromatina enrrollada
sobre histonas
Cromatina
empaquetada
en nucleosomas
Fragmento de
cromosoma
extendido
Fragmento de
cromosoma
condensado
Cromosoma
Cada molécula de ADN se encuentra empaquetada en
los cromosomas en una longitud 10.000 veces menor.
GEN: segmento de ADN cuya secuencia nucleotídica codifica la información
necesaria para producir un producto biológico funcional, como péptido, proteína o RNA.
ATGCCAGGCCCCCCACCAGCCACGTTGGGGCAGCCCCCACAGCTCCCGGCCTTCGGGCCAAGGTGTCGGGGTGCGTCTCCTGGCC
CATCAATACAGATTACATATTTATATCAATCGCGGGCTCTGAGGGCGCCCTCGGAGAGCGGCCCCGCGCCTACGAAACCAAACTG
GGAGTGGTCGCGCGGAAACTCTGGCTCGGGATTGGCTGCGGGCGCCCGCCGCGGTGCGGGGGGATTGCTAATCGTATTCAGCAT
GTTTTGCACAAGAAATGTCAGCCAGAAAGGGCTATCTGCTCCCTTCGCCAAATTATCCCACAACAATGTCATGCTCGGAGAGCCC
CGCCGCGAACTCTTTTTTGGTCGACTCGCTCATCAGCTCGGGCAGAGGCGAGGCAGGCGGCGGTGGTGGTGGCGCGGGGGGCGG
CGGCGGTGGCGGTTACTACGCCCACGGCGGGGTCTACCTGCCGCCCGCCGCCGACCTGCCATACGGGCTGCAGAGCTGCGGGCTC
TTCCCCACGCTGGGCGGCAAGCGCAATGAGGCAGCGTCGCCGGGCAGCGGTGGCGGTGGCGGGGGTCTAGGTCCCGGGGCGCAC
GGCTACGGGCCCTCGCCCATAGACCTGTGGCTAGACGCGCCCCGGTCTTGCCGGATGGAGCCGCCTGACGGGCCGCCGCCGCCGC
CCCAGCAGCAGCCGCCGCCCCCGCCGCAACCACCCCAGCCAGCGCCGCAGGCCACCTCGTGCTCTTTCGCGCAGAACATCAAAG
AAGAGAGCTCCTACTGCCTCTACGACTCGGCGGACAAATGCCCCAAAGTCTCGGCCACCGCCGCCGAACTGGCTCCCTTCCCGCG
GGGCCCGCCGCCCGACGGCTGCGCCCTGGGCACCTCCAGCGGGGTGCCAGTGCCTGGCTACTTCCGCCTTTCTCAGGCCTACGGC
ACCGCCAAGGGCTATGGCAGCGGCGGCGGCGGCGCGCAGCAACTCGGGGCTGGCCCGTTCCCCGCGCAGCCCCCGGGGCGCGGT
TTCGATCTCCCGCCCGCGCTAGCCTCCGGCTCGGCCGATGCGGCCCGGAAGGAGCGAGCCCTCGATTCGCCGCCGCCCCCCACGC
TGGCTTGCGGCAGCGGCGGGGGCTCGCAGGGCGACGAGGAGGCGCACGCGTCGTCCTCGGCCGCGGAGGAGCTCTCCCCGGCCC
CTTCCGAGAGCAGCAAAGCCTCGCCGGAGAAGGATTCCCTGGGTAAGCAGGGCTGCAGAGGGCTGCAGTCAGGCGGGCAGACA
GGCAGACACAAGGAGGAGAAGGATCAGAAAACTAGGAGCCCGCGCAGCAGCCGGCCGGCCTTGGCCCAAGCTGCAGGCAGGCT
GACCTTGTGAACTTGCTTTTTAATATTTGGGCGTGGGGGCGCAGTAAAATTCATGTCCGGCTTAGCGCCCCACAGCAAGACGTCC
TCGGCGCTGGCCTCAGCTCCCCCTGACTAGGGACGAGGACACCAGCGAGCAGGCCCCCTCCTGTGCGCTCTTTCCTGTGGCCGGG
AGGACCCAGAGCCCTGGTCCCTGCCCAGCCTGCGCGGCGCGGCCCACGCGGGGGGAGGGGGAGGGAGGGAAAGTAGCTCGCCC
GCAGATAGCGCGGATGTTTGTAAGGCATCCAAAATAAGCAGCCGCCAGCGCCAATAAATAAGCCCATTAACCGGCGAAGTTCGA
GTGTACGATCCCCCATGCTTTTTTCAAAGTTGCTGAGGGGCGGGAATCTTCGTGGCGGGAAGAAGAAAAGGCAAATCCGGCCTG
GAAGCGGGGGGCCCTGAGCTGAGAGCCAGAGAAGGGCCATTTCCCTTCCCCTGGACCTCGGAATCGCCCAGCTATGTATCCTGG
CTCCTGGAGAAACTTGAGGGAGGGCCCTTGACCCCCGAATCGGTTTTTCCTGCCTTCCCCATTGGACCAATGATGCCCTTCTTTCT
CCCCTTATCGAGTCTTGGGCAATCAGGGCCCTGGGGTGAGACAGCCAAGCTGCCTGGCCCATCTTCCAAGTAAGCACCCCGCGCT
CCTAGCCTGGGGGCTACAGGAAATGCTTGTCTGCCATATGGCAAGAGGCAAAGAAAAGCGTTAAGTTCAAGATGTACAGCCTGC
CCTCCCAGGCTCACAGCCAACTTTAATTTTTCCTGATGAATCTCCAGGCGAC
GEN
Cromosomas
Genoma
Individuo
Replicación
ADN
Transcripción
DOGMA CENTRAL
DE LA GENETICA
ARN
Traducción
Péptido o proteína
•
Eucariotas: tienen membrana
nuclear y orgánulos (plantas,
animales, hongos,…)
•Procariotas: no tienen membrana
que separe núcleo y orgánulos (bacteria)
Esquemas simplificados del proceso de replicación del ADN
ADN de doble cadena
original
Producto
intermediario en la
replicación
semiconservativa
Origen de
replicación
Horquilla de
replicación
Horquilla de
replicación
Dos moléculas de
ADN de doble
cadena hijas
CARACTERISTICAS GENERALES DE LA REPLICACION:
- Semiconservadora.
- Dirección 5’-> 3’.
- Hebras antiparalelas: rezagada y continua.
- Se lleva a cabo en el núcleo de células eucariotas
y en el citosol de procariotas.
Sistema ADN replicasa o Replisoma
Cadena
adelantada
Helicasa
Cebador
ADN
Polimerasa
Fragmentos de
Okazaki
proteínas
de unión al
ADN
Representación esquemática de la replicación del ADN
1-Iniciación. Desenrrollamiento de la doble hélice por
acción de la helicasa, separación de las hebras y
síntesis de la nueva cadena conductora en dirección
5’→3’, por la polimerasa III.
3’
5’
5’
5’
3’
3’
3’
5’
3’
5’
2-Iniciación. Síntesis del
ARN cebador por la primasa.
5’
3’
3’
5’
ARN
cebador
3-Elongación. Síntesis de la
cadena
retardada
corta
(fragmento de Okazaki) por
acción de la polimerasa III a
partir del ARN cebador.
3’
5’
5’
3’
3’
Fragmento
Okazaki
4-Elongación. Eliminación del
ARN cebador por la polimerasa
I y unión del fragmento de
Okazaki al ADN de la cadena
retardada
sintetizada
previamente mediante la ADN
ligasa.
de
3’
5’
5’
3’
5’
3’
5’
3’
5’
Fragmento
Okazaki
5’
3’
5-Elongación. La continuación
de la síntesis de la hebra
conductora, expone otra zona
de cadena única en la mólecula
original para la síntesis de un
nuevo fragmento de Okazaki.
5’
3’
de
Daños espontáneos en el ADN
Reacciones de depurinación y desaminación
Formación de dímeros de timina
Ruptura de la doble cadena
Sistemas de reparación del ADN
Replicación
ADN
Transcripción
DOGMA CENTRAL
DE LA GENETICA
ARN
Traducción
Péptido o proteína
Acidos nucleicos: Estructura del ARN
Tipos de ARN y características específicas
ARN mensajero
ARN
ARN transferencial
ARN ribosomal
Tipo de ARN
Características estructurales
Función
ARN mensajero (mARN)
Transcripto primario.
Cola poli-A 3’.
Caperuza de 7-metil guanosina 5’.
Molde para síntesis
de proteína
ARN transferencial (tARN)
Un tARN específico para c/aa.
Extremo 3’: CCA
Transporte de aa en
la síntesis de
proteínas.
ARN ribosomal (rARN)
Se asocia con proteínas.
3 tamaños diferentes en
procariotas y 4 en eucariotas.
Componente
estructural de
ribosomas
Tipos de ARN: ribosomal, transferencial y
mensajero
ARNt
ARNr
ARNm
Estructura de un gen
Gen: fragmento de ADN que codifica la información necesaria
para la síntesis de un compuesto biológico.
Región codificante del ARN
Secuencia del gen de la beta-globina humana
Representación esquemática de la
iniciación y elongación de la transcripción
σ
Promotor
1- Unión no específica de la Pol
y migración hacia el promotor.
5’
3’
3’
5’
σ
5’
3’
FFF Pu
3’
5’
ADN templado
ARN polimerasa
2- Formación de un complejo
Pol-promotor cerrado.
rNTPs
σ
5’
3’
3’
5’
5- Elongación del mARN en 8
nucleótidos más.
σ
5’
3’
N
3’
σ
5’
3’
3- Formación de un complejo
Pol-promotor abierto.
5’
N
N
3’
N
5’
N
FFF Pu N
N
σ
FFF Pu
σ
5’
3’
4- Iniciación de la síntesis de
mARN, casi siempre con una
purina.
5’
3
’5
3’
’
N
3’
FFF Pu
6- Liberación de la subunidad σ
a medida que la Pol progresa
corriente abajo sobre el ADN.
5’
N
N
N
N
FFF Pu N
N
Complejo de transcripción
Transcripción de un gen eucariota y
maduración del ARNm
5'UTR
3'UTR
Exon 1
preARN:
Intron 1
Exon 2
Exon 3
ATG
TAA
5‘CAP/Splicing /
Polyadenylation
ARNm maduro:
Intron 2
TAA AAAAAAAAA
ATG
active protein:
CPLTW
Maduración del ARNm
CPLTW
Modificación posttransduccional
polyA
-Adición..............GFL
de la cap en
extremo 5´
Splicing alternativo
-Poliadenilación del
extremo 3´
..............PJC
- Eliminación de intrones
..............LAC
(splicing)
CPLTW
Reacciones de adición de la caperuza 5´
(Caping 5´)
La base terminal en 5’ es una
guanina. Un rGDP se añade a la
molécula original de ARN después
de la transcripción, en una
reacción
de
condensación
catalizada por la enzima guanilil
transferasa.
El ribonucleótido (rGDP) añadido,
tiene
orientación
contraria
respecto a los demás nucleótidos.
Así, el extremo 5’ del ARNm tiene
dos nucleótidos conectados por
un enlace trifosfato 5’-5’ y grupos
metilados en distintas posiciones.
Poliadenilación del extremo 3´del ARN
-Se llama cola poli-A a un tramo
de residuos de Adenina que se
adiciona al extremo 3’ del mRNA.
-La secuencia de nucleótidos de
Adenina no está codificada en el
ADN sino que se añade al
transcripto
después
de
la
transcripción.
Poli-A polimerasa
-La adición de la cola está
catalizada por la enzima Poli-A
polimerasa que reconoce la
secuencia
AAUAAA
en
el
transcripto primario y añade
~200 residuos de A al extremo 3’
(-OH libre) del mARN. No
necesita molde.
- La poliadenilación estabiliza el
ARNm.
Sistemas de corte de intrones y empalme de
exones (splicing)
5'UTR
3'UTR
Exon 1
preARN:
Intron 1
Exon 2
Exon 3
Intron 2
ATG
TAA
Splicing
polyA
mARN maduro
TAA AAAAAAAAA
ATG
Traducción
active protein:
CPLTW
..............GFL
Splicing alternativo
CPLTW
..............PJC
Modificación posttransduccional
CPLTW
..............LAC
Mecanismo de splicing
1ºAtaque nucleofílico del 2’- OH de la penúltima A del intrón sobre el
sitio 5’ (-P) del último nucleótido del exón 1 o sitio de splicing.
2º. El extremo 3’-OH libre del exón liberado ataca el enlace en el sitio
3’ de splicing.
Maduración del ARNm
Descargar

Diapositiva 1