Código genético,
ADN y ARN
Los ácido nucléicos (ADN yARN) llevan
información y la transforman en proteínas. Las
proteínas controlan la química de un ser vivo
Los descubridores de la estructura de doble hélice del
ADN, James Watson y Francis Crick, en 1953. Fueron
galardonados con el Premio Nóbel en Medicina y Fisiología
en 1962.
Rosalind Franklin
El trabajo de difracción con rayos X de Rosalind Franklin fue fundamental en
el desarrollo del modelo del ADN. Franklin murió sin saber que los resultados
de sus estudios habían sido informalmente comunicados a Watson y Crick por
M. Wilkins. Ellos fueron galardonados con el Premio Nóbel en 1962.
Rosalind Franklin murió de cáncer en 1958 a la edad de 37 años,
posiblemente a causa de los rayos X usados en sus investigaciones.
Sin embargo aunque Watson, Crick y Wilson luego dieron crédito a la
contribución de Rosalind Franklin, ésta nunca fue nominada o premiada con el
Nóbel pues ya había muerto, y el Premio Nóbel nunca es póstumo.
James Watson, en 2003, cuando se dio por terminado el
Proyecto Genoma Humano, que él dirigió y consiste en
determinar las posiciones relativas de todos los nucleótidos
e identificar los 20.000 a 25.000 genes presentes en los 23
pares de cromosomas del ser humano.
Micropelícula sobre ADN y el Proyecto
Genoma Humano
http://www.pbs.org/wgbh/nova/programs/ht/qt/2809_01.html
http://www.pbs.org/wgbh/nova/programs/ht/qt/2809_q100_02.html
El ADN: estructura y replicación
• El ADN es un polímero (de cadena doble)
de nucleótidos.
• ¿Qué es un nucleótido?:
Bases nitrogenadas de los nucleótidos que forman
los ácidos nucléicos
azúcar de los ácidos nucléicos:
Estructura molecular del ADN
La molécula de ADN tiene la capacidad única de
REPLICARSE. Esto es, sacar una copia de sí
misma que puede ser transmitida a la
descendencia. La replicación se da en el núcleo,
antes de la división celular
http://www.youtube.com/watch?v=qy8dk5iS1f0&feature=related
Juego de simulación de replicación de DNA
http://nobelprize.org/medicine/educational/dna_double_helix/index.html
Replicación del ADN (ácido
desoxirribonucléico)
Replicación del ADN: los nuclétidos
sueltos en el núcleo se adhieren al lugar
indicado: G-C, T-A
Replicación del ADN: es
semiconservativa = se forman dos
dobles cadenas idénticas a la original,
pero en cada una se conserva una
cadena antigua
La replicación del ADN es catalizada
por diferentes enzimas
Videos didácticos sobre el proceso y enzimas que participan:
HTTP://WWW.YOUTUBE.COM/WATCH?V=TEV62ZRM2P0&FEATURE=
RELATED
EL ANTERIOR EN ESPAÑOL:
HTTP://WWW.YOUTUBE.COM/WATCH?V=-EGKRYDQEHQ
HTTP://WWW.YOUTUBE.COM/WATCH?V=WKXGWGN_DGU&FEATUR
E=RELATED
La helicasa rompe los puentes de hidrógeno de la doble hélice
permitiendo el avance de la horquilla de replicación.
Los nucleósidos solo pueden adicionarse por el extremo 3´
La ADN polimerasa sintetiza la cadena complementaria de forma
continua en la hebra adelantada y de forma discontínua en la hebra
rezagada (donde se producen los fragmentos de Okazaki).
El proceso de la replicación se puede dividir en 3 fases: iniciación,
elongación y terminación.
Iniciación de la replicación
• La enzima helicasa se desplaza a lo largo del ADN en
dirección a la horquilla de replicación, es decir, en
dirección 5' → 3' en la hebra rezagada y 3' → 5' en la
hebra adelantada, rompiendo los puentes de hidrógeno
que mantienen unida la doble hélice
Elongación
• La ADN polimerasa comienza a añadir nucleótidos. Así, durante la
síntesis, en cada horquilla de replicación se van formando dos
copias nuevas de ADN, pero debido a la unidireccionalidad de la
actividad polimerasa la replicación sólo puede ser continua en la
hebra adelantada
[En la hebra rezagada es discontinua, dando lugar a los fragmentos
de Okazaki, que son pegados por la enzima ligasa]
• La terminación del proceso se da cuando se llega a un triplete de
nucleótidos TAC , que corresponde a AUG que significa “stop” en
el ARNm (pero esto lo entenderá en los slides de la
transcripción que están más adelante)
Comparación de la estructura
del ADN y ARN
Ver video
http://www.youtube.com/watch?v=
-Q_Lvzdkexo&feature=related
Comparación entre ADN y ARN
ADN
ARN
• Dos cadenas de nucleótidos
formando una doble hélice
• Azúcar de 5 carbonos
• Azúcar: desoxirribosa
• Una sola cadena
• bases: A,C,G,T
Adenina, Citocina, Guanina,
Timina.
• bases: A,C,G,U
(el Uracilo reemplaza a la
Timina)
• función: información de
generación en generación
(replicación)
• función: síntesis proteica
(transcripción y traducción)
• Azúcar de 5 carbonos
• Azúcar: ribosa
ADN y ARN (acido ribonucleico) tienen algunas
diferencias:
Interacción entre ADN y ARN: el ARN mensajero (ARNm) copia o
“transcribe” la información de un trozo de ADN, y lleva este “mensaje” al
organelo celular que “traduce” y compone una proteína con los
aminoácidos en la secuencia que indica el mensaje.
http://www.biology.eku.edu/RITCHISO/301notes1.htm
Tipos de ARN: ARNm
El ARN mensajero
• Copia o transcribe la
información del ADN
del núcleo.
• Saca la información al
citoplasma y la lleva al
ribosoma
• La información va en
tripletes de
nucleótidos llamados
codones
CODÓN = tres nucleótidos que significan un
aminoácido determinado
El codón TCA del ADN
en el ARN mensajero se
convierte en AGU que
significa agregar el
aminoácido Serrina
(Ser) a la secuencia de
aminoácidos de la
nueva proteína que se
formará
Ver animación:
http://biomodel.uah.es/model4/dna/dnacode.htm
Transcripción
• http://www.youtube.com/watch?v=983lhh2
0rGY
Tipos de ARN: ARNr
ARN ribosomal
• Constituye el
organelo llamado
ribosoma
• Allí se traduce o se
sintetiza la nueva
proteína en base a
la información del
ARNm, y con la
ayuda del ARNt
Tipos de ARN: ARNt
ARN de transferencia
• Su función es llevar
aminoácidos al
ribosoma para la
síntesis de la nueva
proteína.
• En un extremo lleva
un anticodón para
identificar al codón del
respectivo aminoácido
Cómo los anticodones del ARNt identifican al
respectivo codón en el ARNm
El ARNt (ARN de transferencia) tiene tres nucleótidos (anticodòn) que
identifican al respectivo codòn, y asì anexar el aminoàcido que
transportan al ribosoma, para formar o sintetizar una proteìna
¿Cómo adquiere su estructura
funcional una molécula de RNAt?
VIDEO:
http://www.hhmi.org/biointeractive/media/rnafold-lg.wmv
El código genético: es el significado de la
información del ADN:
Cada tres nucleótidos codifican
a un aminoácido distinto, para
formar la nueva proteína
Pelìcula introductoria
http://www.pbs.org/wgbh/nova/ge
nome/program.html
El código genético
• La secuencia de bases del ARNm es usada por el
ribosoma como plantilla para ensamblar la secuencia de
aminoácidos que formarán el polipéptido (proteína).
• El proceso se llama TRADUCCIÓN, y el “diccionario” de
traducción es el código genético.
• Las “palabras” del código son los codones, que son
tripletes del bases del ARNm. Ej: UUU, CAG,UGA.
• Hay 64 codones posibles, y cada codón corresponde a
uno o más aminoácidos. Por ejemplo, el codón UUU
corresponde al aminoácido Fenilalanina.
El código genético
• Como solo hay 20 aminácidos posibles, algunos son
codificados por varios codones distintos. Por ejemplo, el
aminoácido Isoleucaina es codificado por tres codones
distintos: AUU, AUC, AUA. (ver tabla en siguientes
slides)
• Por el hecho de que varios codones pueden
corresponder a un solo aminoácido, el código genético
es llamado “degenerado”
• El código genético es “universal”, pues es idéntico para
todos los seres vivos, desde las bacterias hasta el
hombre. Esto tiene implicaciones en la ingeniería
genética entre especies.
El código genético
• Hay algunas raras excepciones a la
“universalidad” del código genético: algunos
codones de “stop” son usados para codificar
aminoácidos especiales.
• La traducción se realiza en los ribosomas, que
están hechos de ARNr y se encuentran en el
citoplasma de la célula.
Transcripción
• El ARNm se forma en el proceso llamado
transcripción.
• El ARNm “transcribe” o copia la
información de la secuencia de bases del
una de las cadenas del ADN del núcleo, y
lo saca al citoplasma.
• Hay que recordar que en el ARNm la base
uracilo está presente en vez de la timina.
Por lo tanto al ir copiando el mensaje, las
bases se aparean así: U-A, A-T, C-G, G-C
Transcripción
• La cadena de ADN tiene una cadena con
“sentido”, o sea con información sobre la
secuencia de aminoácidos de la proteína,
y la otra cadena, que es complementaria,
es “sin sentido”. El ARNm copia la cadena
“sin sentido”, siendo así un réplica de la
cadena “con sentido” que lleva el orden de
la secuencia de aminoácidos
Transcripción
• El proceso de transcripción empieza
cuando la enzima ARN polimerasa se
adhiere a un sitio llamado promotor en el
DNA.
• Sitio promotor determina qué cadena se
va a transcribir.
• La ARN polimerasa abre la doble
cadena, y cataliza la formación de enlaces
covalentes entre los nucleótidos del nuevo
ARNm que se está formando.
Los 20 aminoácidos en español y sus abreviaturas
.
1*
Base
U
Segunda base
U
C
A
G
3*
Base
UUU
UCU
UAU
UGU
U
UUC
UUA
UUG
CUU
C
CUC
CUA
CUG
AUU
A
AUC
Phe
Leu
Leu
Leu
Ile
AUA Ile
UCC
UCA
UCG
CCU
CCC
CCA
CCG
ACU
ACC
ACA
AUG Met ACG
GUU
G
GUC
GUA
GUG
Val
Val
GCU
GCC
GCA
GCG
Ser
Ser
Pro
Pro
Thr
Thr
Ala
Ala
UAC
UAA
UAG
CAU
CAC
CAA
CAG
AAU
AAC
AAA
AAG
GAU
GAC
GAA
GAG
Tyr
Stop
His
Gln
Asn
Lys
Asp
Glu
UGC
Cys
C
UGA Stop
A
UGG Trp
G
CGU
U
CGC
CGA
CGG
AGU
AGC
AGA
AGG
GGU
GGC
GGA
GGG
Arg
C
A
Arg
G
U
Ser
C
A
Arg
G
U
Gly
C
A
Gly
G
http://cabronio.blogspot.com/2008/08/codones-y-animocidos.html
Traducción
• El mensaje es llevado en la misma
molécula de ARNm hacia el ribosoma
(ARNr) para ser “traducido”.
• El resultado de esa “traducción” es la
formación o síntesis de la nueva proteína
con una secuencia de aminoácidos dada
por el orden de los codones del ARNm.
• El ARNt transporta aminoácidos
específicos para esta síntesis.
Traducción: pasos
• Iniciación: el ARNm se une al ribosoma y
el codón iniciador AUG empieza el
proceso.
• Elongación: se empiezan a adicionar lo
aminoácidos llevados por los ARNt
• Terminación: se pone el último
aminoácido cuando se llega al codón de
terminación.
Síntesis de proteínas
Síntesis de proteínas
Síntesis de proteínas
Generalmente, más de un ribosoma puede estar
“traduciendo” la misma molécula de ARNm al mismo
tiempo. Este grupo o complejo de ribosomas actuando a la
vez se conoce como polirribosoma o polisoma
replicación, transcripción y
traducción
http://www.johnkyrk.com/DNAanatomy.html
Traducción y síntesis proteica con Mario Bros
HTTP://WWW.YOUTUBE.COM/WATCH?V=ZPLNDZKBRPC
Juego de transcripción y
traducción
• Genetic Science Learning Center.
"Transcribe y traduce un Gen."
Learn.Genetics 15 October 2012
http://learn.genetics.utah.edu/es/units/basi
cs/transcribe/
Ejercicio:
Dada la siguiente cadena de ADN que acaba de ser abierta por la enzima
helicasa:
TACTACGGCATAGAGTCGATTGCGAAT
a) Construir su cadena complementaria del ARNm
b) Construir la proteína resultante de la traducción de ese ARNm, utilizando
el código genético.
(Tener en cuenta la tabla con los codones del ARNm y los respectivos
aminoácidos)
Los cromosomas de eucariotas están
constituidos por ADN y proteínas (histonas).
en las bacterias el ADN está desnudo en el
citoplasma.
El ADN se encuentra compactado
o “condensado” en el núcleo. Un
primer nivel de condensación se
forma gracias a la unión de cierto
tipo de proteínas, denominadas
histonas, a manera de un collar
de cuentas: el ADN rodea un
núcleo compuesto por ocho
histonas. Este núcleo rodeado
por ADN, más el ADN espaciador
entre las cuentas, se denomina
nucleosoma y fue descubierto
en 1975 por Roger Kornberg,
Dean Hewish y Leigh Burgoyne.
Cada nucleosoma contiene un
pedazo de ADN de 146
nucleótidos más ocho histonas.
http://aportes.educ.ar/biologia/nucleo-teorico/estado-delarte/una-gran-biblioteca-cromosomas-ygenes/como_entra_todo_el_adn_en_el_n.php
http://www.cbs.dtu.dk/staff/dave/roanoke/fig6_10.jpg
Vista al microscopio de
los cromosomas tal
como se ven en el
núcleo durante la
división celular
(metafase).
El ADN ya está
replicado y forma los
dos brazos del
cromosoma
(cromátidas) unidos en
un punto (centrómero)
FIN
Descargar

Diapositiva 1